HUGE

Gene/Protein Characteristic Table for KIAA1989

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04991
Accession No. :	AB076400
Description :	FAT tumor suppressor homolog 3 (Fragment).
HUGO Gene Name :	FAT tumor suppressor homolog 3 (Drosophila) (FAT3)
Clone Name :	fh00385 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5340 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2045 bp

Genome contig ID gi51511727f_92113483
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTTTTTTATGAGTCAGTGTTTCTGAATGTTTATGC
Flanking genome sequence
(152491 - 152540)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAATCCTTTTTCATTCCCAAACTTTCTAAGTAAGTGGATACA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 f 92213483 92265972 11 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1097 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAB86868	100.0	fat3 [Homo sapi...	Homo sapiens
Q8TDW7	99.9	Protocadherin F...	Homo sapiens
XP_848507	95.4	similar to FAT ...	Canis lupus fam...
EAW66887	99.9	hCG21202, isofo...	Homo sapiens
NP_001008781	97.0	FAT tumor suppr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB160984	4.7e-20	27.5	KIAA0811
AB011538	1.3e-09	25.8	KIAA0814
AB011537	6.6e-09	26.7	KIAA0813
AB058677	5.1e-06	38.6	KIAA1781
D87469	6.5e-06	24.1	KIAA0279

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002126 65 146 PF00028 Cadherin

IPR012680 373 502 PF02210 Laminin G

IPR006209 533 565 PF00008 EGF-like

IPR006209 572 603 PF00008 EGF-like

IPR006209 610 641 PF00008 EGF-like

HMMSmart IPR006210 306 341 SM00181 EGF

IPR001791 365 502 SM00282 Laminin G

IPR001881 531 566 SM00179 EGF-like calcium-binding

IPR006210 532 566 SM00181 EGF

IPR001881 568 604 SM00179 EGF-like calcium-binding

IPR006210 571 604 SM00181 EGF

IPR001881 606 642 SM00179 EGF-like calcium-binding

IPR006210 609 642 SM00181 EGF

ProfileScan IPR002126 70 161 PS50268 Cadherin

IPR000742 303 341 PS50026 EGF-like

IPR001791 343 526 PS50025 Laminin G

IPR000742 529 566 PS50026 EGF-like

IPR000742 568 604 PS50026 EGF-like

IPR000742 606 642 PS50026 EGF-like

ScanRegExp IPR013032 554 565 PS00022 EGF-like region

IPR013032 592 603 PS00022 EGF-like region

IPR001881 606 630 PS01187 EGF-like calcium-binding

IPR000152 621 632 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 630 641 PS00022 EGF-like region

IPR013032 630 641 PS01186 EGF-like region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002126	65	146	PF00028	Cadherin
IPR012680	373	502	PF02210	Laminin G
IPR006209	533	565	PF00008	EGF-like
IPR006209	572	603	PF00008	EGF-like
IPR006209	610	641	PF00008	EGF-like
HMMSmart	IPR006210	306	341	SM00181	EGF
IPR001791	365	502	SM00282	Laminin G
IPR001881	531	566	SM00179	EGF-like calcium-binding
IPR006210	532	566	SM00181	EGF
IPR001881	568	604	SM00179	EGF-like calcium-binding
IPR006210	571	604	SM00181	EGF
IPR001881	606	642	SM00179	EGF-like calcium-binding
IPR006210	609	642	SM00181	EGF
ProfileScan	IPR002126	70	161	PS50268	Cadherin
IPR000742	303	341	PS50026	EGF-like
IPR001791	343	526	PS50025	Laminin G
IPR000742	529	566	PS50026	EGF-like
IPR000742	568	604	PS50026	EGF-like
IPR000742	606	642	PS50026	EGF-like
ScanRegExp	IPR013032	554	565	PS00022	EGF-like region
IPR013032	592	603	PS00022	EGF-like region
IPR001881	606	630	PS01187	EGF-like calcium-binding
IPR000152	621	632	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	630	641	PS00022	EGF-like region
IPR013032	630	641	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 615 CENGGSCVNVFGSFLCNCTPGY 636 SECONDARY 22

2 663 LIGIAVVLFVIFILVVLFIVFR 684 PRIMARY 22

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	615	CENGGSCVNVFGSFLCNCTPGY	636	SECONDARY	22
2	663	LIGIAVVLFVIFILVVLFIVFR	684	PRIMARY	22

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGAAAGTTGACAGGTTGAGGG

Primer_r
: AATAATGCACAGACTAGGGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: genbank
Primer_f	: TGAAAGTTGACAGGTTGAGGG
Primer_r	: AATAATGCACAGACTAGGGAC
PCR product length	: 185 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2045 bp
Genome contig ID	gi51511727f_92113483
PolyA signal sequence (None)	+--------+--------+----*----+---- CTTTTTTATGAGTCAGTGTTTCTGAATGTTTATGC
Flanking genome sequence (152491 - 152540)	----+--------+--------+--------+--------+----* AAAAAAAAAAATCCTTTTTCATTCCCAAACTTTCTAAGTAAGTGGATACA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	f	92213483	92265972	11	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA1989

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information