HUGE

Gene/Protein Characteristic Table for KIAA0811

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04990
Accession No. :	AB160984
Description :	Protocadherin Fat 2 precursor.
HUGO Gene Name :
Clone Name :	hj04806 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4846 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1473 bp

Genome contig ID gi51511721r_150763955
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TTTTTTTTAACAATAAAGTATCTTTTTTTACTGTT
Flanking genome sequence
(99892 - 99843)
----+----*----+----*----+----*----+----*----+----*
ATTTTCTGTGTCCTTTAGCCTGTTTGGGGTCAGGGGAACGATGCAAGGGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 r 150863847 150891731 11 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 1123 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NYQ8	92.8	Protocadherin F...	Homo sapiens
NP_001438	92.8	FAT tumor suppr...	Homo sapiens
EAW61673	92.6	FAT tumor suppr...	Homo sapiens
XP_001168406	91.9	FAT tumor suppr...	Pan troglodytes
XP_001110265	89.1	similar to FAT ...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87469	2.1e-22	26.1	KIAA0279
AB076400	3.3e-19	27.4	KIAA1989
AB053446	3.4e-18	32.5	KIAA1773
AB002325	9.6e-18	33.5	KIAA0327
AB053445	5.7e-16	31.1	KIAA1774

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002126 122 141 PR00205 Cadherin

IPR002126 181 210 PR00205 Cadherin

IPR002126 251 263 PR00205 Cadherin

IPR002126 265 284 PR00205 Cadherin

IPR002126 284 297 PR00205 Cadherin

IPR002126 339 365 PR00205 Cadherin

IPR002126 373 390 PR00205 Cadherin

HMMPfam IPR002126 1 69 PF00028 Cadherin

IPR002126 83 172 PF00028 Cadherin

IPR002126 186 277 PF00028 Cadherin

IPR002126 291 382 PF00028 Cadherin

IPR002126 396 480 PF00028 Cadherin

IPR006209 725 757 PF00008 EGF-like

IPR006209 764 795 PF00008 EGF-like

HMMSmart IPR002126 1 76 SM00112 Cadherin

IPR002126 101 179 SM00112 Cadherin

IPR002126 203 284 SM00112 Cadherin

IPR002126 308 389 SM00112 Cadherin

IPR002126 413 487 SM00112 Cadherin

IPR001881 721 758 SM00179 EGF-like calcium-binding

IPR006210 724 758 SM00181 EGF

IPR001881 761 796 SM00179 EGF-like calcium-binding

IPR006210 763 796 SM00181 EGF

ProfileScan IPR002126 1 78 PS50268 Cadherin

IPR002126 79 181 PS50268 Cadherin

IPR002126 182 286 PS50268 Cadherin

IPR002126 287 391 PS50268 Cadherin

IPR002126 392 502 PS50268 Cadherin

IPR000742 721 758 PS50026 EGF-like

IPR000742 760 796 PS50026 EGF-like

ScanRegExp IPR002126 274 284 PS00232 Cadherin

IPR013032 746 757 PS00022 EGF-like region

IPR013032 784 795 PS00022 EGF-like region

IPR013032 784 795 PS01186 EGF-like region

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	122	141	PR00205	Cadherin
IPR002126	181	210	PR00205	Cadherin
IPR002126	251	263	PR00205	Cadherin
IPR002126	265	284	PR00205	Cadherin
IPR002126	284	297	PR00205	Cadherin
IPR002126	339	365	PR00205	Cadherin
IPR002126	373	390	PR00205	Cadherin
HMMPfam	IPR002126	1	69	PF00028	Cadherin
IPR002126	83	172	PF00028	Cadherin
IPR002126	186	277	PF00028	Cadherin
IPR002126	291	382	PF00028	Cadherin
IPR002126	396	480	PF00028	Cadherin
IPR006209	725	757	PF00008	EGF-like
IPR006209	764	795	PF00008	EGF-like
HMMSmart	IPR002126	1	76	SM00112	Cadherin
IPR002126	101	179	SM00112	Cadherin
IPR002126	203	284	SM00112	Cadherin
IPR002126	308	389	SM00112	Cadherin
IPR002126	413	487	SM00112	Cadherin
IPR001881	721	758	SM00179	EGF-like calcium-binding
IPR006210	724	758	SM00181	EGF
IPR001881	761	796	SM00179	EGF-like calcium-binding
IPR006210	763	796	SM00181	EGF
ProfileScan	IPR002126	1	78	PS50268	Cadherin
IPR002126	79	181	PS50268	Cadherin
IPR002126	182	286	PS50268	Cadherin
IPR002126	287	391	PS50268	Cadherin
IPR002126	392	502	PS50268	Cadherin
IPR000742	721	758	PS50026	EGF-like
IPR000742	760	796	PS50026	EGF-like
ScanRegExp	IPR002126	274	284	PS00232	Cadherin
IPR013032	746	757	PS00022	EGF-like region
IPR013032	784	795	PS00022	EGF-like region
IPR013032	784	795	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 822 ELLIITVAVAFIIISTVGLLFYC 844 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	822	ELLIITVAVAFIIISTVGLLFYC	844	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACTCACACAAATTGGCTCTCG

Primer_r
: GGTCCACTGCCTTTTCATATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1473 bp
Genome contig ID	gi51511721r_150763955
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTTTTTTTAACAATAAAGTATCTTTTTTTACTGTT
Flanking genome sequence (99892 - 99843)	----+--------+--------+--------+--------+----* ATTTTCTGTGTCCTTTAGCCTGTTTGGGGTCAGGGGAACGATGCAAGGGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	r	150863847	150891731	11	99.3	Perfect prediction

Primer_f	: ACTCACACAAATTGGCTCTCG
Primer_r	: GGTCCACTGCCTTTTCATATG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0811

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information