HUGE

Gene/Protein Characteristic Table for KIAA0814

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK01606
Accession No. :	AB011538
Description :	Slit homolog 3 protein precursor.
HUGO Gene Name :
Clone Name :	fh16048 [Vector Info]
Flexi ORF Clone :	pF1KSDA0814
Source :	Human fetal brain
Note :	We replaced hg02635, former representative clones for KIAA0814 with fh16048. (1998/8/22)

Features of the cloned DNA sequence	Description

Length: 5156 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 164 bp

Genome contig ID gi51511721r_167925873
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TAAGTATATTGTAAAATAAACAAAAAATAGAACTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTTTATTATGGAAAGTGACTATTTTCATCTTTTATTATATAAATATAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 r 168025873 168660711 35 100.0 Internal No-hit

Features of the protein sequence	Description

Length: 1559 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAA32466	100.0	MEGF5 [Homo sap...	Homo sapiens
O75094	100.0	Slit homolog 3 ...	Homo sapiens
AAQ89243	99.9	SLIT3 [Homo sap...	Homo sapiens
O88280	93.9	Slit homolog 3 ...	Rattus norvegicus
CAI25608	94.0	slit homolog 3 ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011537	0	59.0	KIAA0813
D87469	1.3e-15	26.9	KIAA0279
D86983	1.6e-13	34.5	KIAA0230
AB011539	3.4e-13	25.8	KIAA0815
AB067497	9.4e-13	23.6	KIAA1910

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 171 184 PR00019 Leucine-rich repeat

IPR001611 592 605 PR00019 Leucine-rich repeat

HMMPfam IPR000372 69 96 PF01462 Leucine-rich repeat

IPR001611 98 120 PF00560 Leucine-rich repeat

IPR001611 122 144 PF00560 Leucine-rich repeat

IPR001611 146 168 PF00560 Leucine-rich repeat

IPR001611 170 192 PF00560 Leucine-rich repeat

IPR001611 194 216 PF00560 Leucine-rich repeat

IPR001611 218 240 PF00560 Leucine-rich repeat

IPR000483 275 300 PF01463 Cysteine-rich flanking region

IPR000372 315 342 PF01462 Leucine-rich repeat

IPR001611 368 390 PF00560 Leucine-rich repeat

IPR001611 392 414 PF00560 Leucine-rich repeat

IPR001611 440 462 PF00560 Leucine-rich repeat

IPR000483 497 522 PF01463 Cysteine-rich flanking region

IPR000372 540 567 PF01462 Leucine-rich repeat

IPR001611 594 616 PF00560 Leucine-rich repeat

IPR001611 618 640 PF00560 Leucine-rich repeat

IPR001611 642 664 PF00560 Leucine-rich repeat

IPR001611 666 688 PF00560 Leucine-rich repeat

IPR000483 723 748 PF01463 Cysteine-rich flanking region

IPR000372 760 787 PF01462 Leucine-rich repeat

IPR001611 789 810 PF00560 Leucine-rich repeat

IPR001611 812 834 PF00560 Leucine-rich repeat

IPR001611 836 858 PF00560 Leucine-rich repeat

IPR001611 860 882 PF00560 Leucine-rich repeat

IPR000483 917 942 PF01463 Cysteine-rich flanking region

IPR006209 956 988 PF00008 EGF-like

IPR006209 995 1029 PF00008 EGF-like

IPR006209 1036 1067 PF00008 EGF-like

IPR006209 1074 1107 PF00008 EGF-like

IPR006209 1114 1145 PF00008 EGF-like

IPR006209 1159 1190 PF00008 EGF-like

IPR012680 1222 1350 PF02210 Laminin G

IPR006209 1368 1400 PF00008 EGF-like

IPR006209 1408 1438 PF00008 EGF-like

IPR006209 1448 1479 PF00008 EGF-like

HMMSmart IPR000372 69 101 SM00013 Leucine-rich repeat

IPR003591 95 119 SM00369 Leucine-rich repeat

IPR003591 120 143 SM00369 Leucine-rich repeat

NULL 120 141 SM00365 NULL

NULL 144 163 SM00364 NULL

IPR003591 144 167 SM00369 Leucine-rich repeat

NULL 144 165 SM00365 NULL

NULL 168 194 SM00365 NULL

IPR003591 168 191 SM00369 Leucine-rich repeat

NULL 168 187 SM00364 NULL

IPR003591 192 215 SM00369 Leucine-rich repeat

IPR003591 216 239 SM00369 Leucine-rich repeat

IPR003590 240 268 SM00368 Leucine-rich repeat

IPR000483 251 300 SM00082 Cysteine-rich flanking region

IPR000372 315 347 SM00013 Leucine-rich repeat

IPR003591 341 365 SM00369 Leucine-rich repeat

NULL 366 387 SM00365 NULL

IPR003591 366 389 SM00369 Leucine-rich repeat

IPR003591 390 413 SM00369 Leucine-rich repeat

IPR003590 390 416 SM00368 Leucine-rich repeat

NULL 390 412 SM00365 NULL

IPR003591 414 437 SM00369 Leucine-rich repeat

IPR003591 438 461 SM00369 Leucine-rich repeat

NULL 438 460 SM00365 NULL

IPR003590 462 490 SM00368 Leucine-rich repeat

IPR000483 473 522 SM00082 Cysteine-rich flanking region

IPR000372 540 572 SM00013 Leucine-rich repeat

IPR003590 592 625 SM00368 Leucine-rich repeat

NULL 592 611 SM00364 NULL

IPR003591 592 615 SM00369 Leucine-rich repeat

IPR003591 617 639 SM00369 Leucine-rich repeat

IPR003591 640 663 SM00369 Leucine-rich repeat

NULL 640 661 SM00365 NULL

IPR003591 664 687 SM00369 Leucine-rich repeat

NULL 664 685 SM00365 NULL

IPR000483 699 748 SM00082 Cysteine-rich flanking region

IPR000372 760 792 SM00013 Leucine-rich repeat

NULL 787 806 SM00364 NULL

NULL 810 836 SM00365 NULL

IPR003591 810 833 SM00369 Leucine-rich repeat

IPR003590 834 860 SM00368 Leucine-rich repeat

NULL 834 853 SM00364 NULL

IPR003591 834 857 SM00369 Leucine-rich repeat

IPR003591 858 881 SM00369 Leucine-rich repeat

IPR003590 882 910 SM00368 Leucine-rich repeat

IPR000483 893 942 SM00082 Cysteine-rich flanking region

IPR001881 952 989 SM00179 EGF-like calcium-binding

IPR006210 955 989 SM00181 EGF

IPR001881 991 1030 SM00179 EGF-like calcium-binding

IPR006210 994 1030 SM00181 EGF

IPR001881 1032 1068 SM00179 EGF-like calcium-binding

IPR006210 1035 1068 SM00181 EGF

IPR001881 1071 1108 SM00179 EGF-like calcium-binding

IPR006210 1073 1108 SM00181 EGF

IPR001881 1110 1146 SM00179 EGF-like calcium-binding

IPR006210 1113 1146 SM00181 EGF

IPR006210 1158 1191 SM00181 EGF

IPR001881 1159 1191 SM00179 EGF-like calcium-binding

IPR001791 1214 1350 SM00282 Laminin G

IPR006210 1367 1401 SM00181 EGF

IPR001881 1371 1401 SM00179 EGF-like calcium-binding

IPR001881 1404 1439 SM00179 EGF-like calcium-binding

IPR006210 1407 1439 SM00181 EGF

IPR001881 1440 1480 SM00179 EGF-like calcium-binding

IPR006210 1447 1480 SM00181 EGF

IPR006207 1491 1559 SM00041 Cystine knot

ProfileScan IPR000742 954 989 PS50026 EGF-like

IPR000742 991 1030 PS50026 EGF-like

IPR000742 1032 1068 PS50026 EGF-like

IPR000742 1070 1108 PS50026 EGF-like

IPR000742 1110 1146 PS50026 EGF-like

IPR000742 1155 1191 PS50026 EGF-like

IPR001791 1194 1368 PS50025 Laminin G

IPR000742 1376 1401 PS50026 EGF-like

IPR000742 1404 1439 PS50026 EGF-like

IPR000742 1444 1480 PS50026 EGF-like

IPR006207 1485 1559 PS01225 Cystine knot

ScanRegExp IPR013032 977 988 PS00022 EGF-like region

IPR013032 1018 1029 PS00022 EGF-like region

IPR013032 1018 1029 PS01186 EGF-like region

IPR001881 1032 1056 PS01187 EGF-like calcium-binding

IPR000152 1047 1058 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 1056 1067 PS00022 EGF-like region

IPR013032 1096 1107 PS00022 EGF-like region

IPR013032 1096 1107 PS01186 EGF-like region

IPR001881 1110 1134 PS01187 EGF-like calcium-binding

IPR000152 1125 1136 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 1134 1145 PS00022 EGF-like region

IPR013032 1134 1145 PS01186 EGF-like region

IPR013032 1179 1190 PS00022 EGF-like region

IPR013032 1179 1190 PS01186 EGF-like region

IPR013032 1389 1400 PS00022 EGF-like region

IPR013032 1389 1400 PS01186 EGF-like region

IPR013032 1427 1438 PS00022 EGF-like region

IPR013032 1427 1438 PS01186 EGF-like region

IPR013032 1468 1479 PS00022 EGF-like region

IPR013032 1468 1479 PS01186 EGF-like region

IPR006207 1522 1558 PS01185 Cystine knot

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	171	184	PR00019	Leucine-rich repeat
IPR001611	592	605	PR00019	Leucine-rich repeat
HMMPfam	IPR000372	69	96	PF01462	Leucine-rich repeat
IPR001611	98	120	PF00560	Leucine-rich repeat
IPR001611	122	144	PF00560	Leucine-rich repeat
IPR001611	146	168	PF00560	Leucine-rich repeat
IPR001611	170	192	PF00560	Leucine-rich repeat
IPR001611	194	216	PF00560	Leucine-rich repeat
IPR001611	218	240	PF00560	Leucine-rich repeat
IPR000483	275	300	PF01463	Cysteine-rich flanking region
IPR000372	315	342	PF01462	Leucine-rich repeat
IPR001611	368	390	PF00560	Leucine-rich repeat
IPR001611	392	414	PF00560	Leucine-rich repeat
IPR001611	440	462	PF00560	Leucine-rich repeat
IPR000483	497	522	PF01463	Cysteine-rich flanking region
IPR000372	540	567	PF01462	Leucine-rich repeat
IPR001611	594	616	PF00560	Leucine-rich repeat
IPR001611	618	640	PF00560	Leucine-rich repeat
IPR001611	642	664	PF00560	Leucine-rich repeat
IPR001611	666	688	PF00560	Leucine-rich repeat
IPR000483	723	748	PF01463	Cysteine-rich flanking region
IPR000372	760	787	PF01462	Leucine-rich repeat
IPR001611	789	810	PF00560	Leucine-rich repeat
IPR001611	812	834	PF00560	Leucine-rich repeat
IPR001611	836	858	PF00560	Leucine-rich repeat
IPR001611	860	882	PF00560	Leucine-rich repeat
IPR000483	917	942	PF01463	Cysteine-rich flanking region
IPR006209	956	988	PF00008	EGF-like
IPR006209	995	1029	PF00008	EGF-like
IPR006209	1036	1067	PF00008	EGF-like
IPR006209	1074	1107	PF00008	EGF-like
IPR006209	1114	1145	PF00008	EGF-like
IPR006209	1159	1190	PF00008	EGF-like
IPR012680	1222	1350	PF02210	Laminin G
IPR006209	1368	1400	PF00008	EGF-like
IPR006209	1408	1438	PF00008	EGF-like
IPR006209	1448	1479	PF00008	EGF-like
HMMSmart	IPR000372	69	101	SM00013	Leucine-rich repeat
IPR003591	95	119	SM00369	Leucine-rich repeat
IPR003591	120	143	SM00369	Leucine-rich repeat
NULL	120	141	SM00365	NULL
NULL	144	163	SM00364	NULL
IPR003591	144	167	SM00369	Leucine-rich repeat
NULL	144	165	SM00365	NULL
NULL	168	194	SM00365	NULL
IPR003591	168	191	SM00369	Leucine-rich repeat
NULL	168	187	SM00364	NULL
IPR003591	192	215	SM00369	Leucine-rich repeat
IPR003591	216	239	SM00369	Leucine-rich repeat
IPR003590	240	268	SM00368	Leucine-rich repeat
IPR000483	251	300	SM00082	Cysteine-rich flanking region
IPR000372	315	347	SM00013	Leucine-rich repeat
IPR003591	341	365	SM00369	Leucine-rich repeat
NULL	366	387	SM00365	NULL
IPR003591	366	389	SM00369	Leucine-rich repeat
IPR003591	390	413	SM00369	Leucine-rich repeat
IPR003590	390	416	SM00368	Leucine-rich repeat
NULL	390	412	SM00365	NULL
IPR003591	414	437	SM00369	Leucine-rich repeat
IPR003591	438	461	SM00369	Leucine-rich repeat
NULL	438	460	SM00365	NULL
IPR003590	462	490	SM00368	Leucine-rich repeat
IPR000483	473	522	SM00082	Cysteine-rich flanking region
IPR000372	540	572	SM00013	Leucine-rich repeat
IPR003590	592	625	SM00368	Leucine-rich repeat
NULL	592	611	SM00364	NULL
IPR003591	592	615	SM00369	Leucine-rich repeat
IPR003591	617	639	SM00369	Leucine-rich repeat
IPR003591	640	663	SM00369	Leucine-rich repeat
NULL	640	661	SM00365	NULL
IPR003591	664	687	SM00369	Leucine-rich repeat
NULL	664	685	SM00365	NULL
IPR000483	699	748	SM00082	Cysteine-rich flanking region
IPR000372	760	792	SM00013	Leucine-rich repeat
NULL	787	806	SM00364	NULL
NULL	810	836	SM00365	NULL
IPR003591	810	833	SM00369	Leucine-rich repeat
IPR003590	834	860	SM00368	Leucine-rich repeat
NULL	834	853	SM00364	NULL
IPR003591	834	857	SM00369	Leucine-rich repeat
IPR003591	858	881	SM00369	Leucine-rich repeat
IPR003590	882	910	SM00368	Leucine-rich repeat
IPR000483	893	942	SM00082	Cysteine-rich flanking region
IPR001881	952	989	SM00179	EGF-like calcium-binding
IPR006210	955	989	SM00181	EGF
IPR001881	991	1030	SM00179	EGF-like calcium-binding
IPR006210	994	1030	SM00181	EGF
IPR001881	1032	1068	SM00179	EGF-like calcium-binding
IPR006210	1035	1068	SM00181	EGF
IPR001881	1071	1108	SM00179	EGF-like calcium-binding
IPR006210	1073	1108	SM00181	EGF
IPR001881	1110	1146	SM00179	EGF-like calcium-binding
IPR006210	1113	1146	SM00181	EGF
IPR006210	1158	1191	SM00181	EGF
IPR001881	1159	1191	SM00179	EGF-like calcium-binding
IPR001791	1214	1350	SM00282	Laminin G
IPR006210	1367	1401	SM00181	EGF
IPR001881	1371	1401	SM00179	EGF-like calcium-binding
IPR001881	1404	1439	SM00179	EGF-like calcium-binding
IPR006210	1407	1439	SM00181	EGF
IPR001881	1440	1480	SM00179	EGF-like calcium-binding
IPR006210	1447	1480	SM00181	EGF
IPR006207	1491	1559	SM00041	Cystine knot
ProfileScan	IPR000742	954	989	PS50026	EGF-like
IPR000742	991	1030	PS50026	EGF-like
IPR000742	1032	1068	PS50026	EGF-like
IPR000742	1070	1108	PS50026	EGF-like
IPR000742	1110	1146	PS50026	EGF-like
IPR000742	1155	1191	PS50026	EGF-like
IPR001791	1194	1368	PS50025	Laminin G
IPR000742	1376	1401	PS50026	EGF-like
IPR000742	1404	1439	PS50026	EGF-like
IPR000742	1444	1480	PS50026	EGF-like
IPR006207	1485	1559	PS01225	Cystine knot
ScanRegExp	IPR013032	977	988	PS00022	EGF-like region
IPR013032	1018	1029	PS00022	EGF-like region
IPR013032	1018	1029	PS01186	EGF-like region
IPR001881	1032	1056	PS01187	EGF-like calcium-binding
IPR000152	1047	1058	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	1056	1067	PS00022	EGF-like region
IPR013032	1096	1107	PS00022	EGF-like region
IPR013032	1096	1107	PS01186	EGF-like region
IPR001881	1110	1134	PS01187	EGF-like calcium-binding
IPR000152	1125	1136	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	1134	1145	PS00022	EGF-like region
IPR013032	1134	1145	PS01186	EGF-like region
IPR013032	1179	1190	PS00022	EGF-like region
IPR013032	1179	1190	PS01186	EGF-like region
IPR013032	1389	1400	PS00022	EGF-like region
IPR013032	1389	1400	PS01186	EGF-like region
IPR013032	1427	1438	PS00022	EGF-like region
IPR013032	1427	1438	PS01186	EGF-like region
IPR013032	1468	1479	PS00022	EGF-like region
IPR013032	1468	1479	PS01186	EGF-like region
IPR006207	1522	1558	PS01185	Cystine knot

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCTAACCTTTCCCTTCACCAG
Primer_r	: GTAATGCCCTATGACTCCTCC
PCR product length	: 165 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	164 bp
Genome contig ID	gi51511721r_167925873
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TAAGTATATTGTAAAATAAACAAAAAATAGAACTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTTTATTATGGAAAGTGACTATTTTCATCTTTTATTATATAAATATAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	r	168025873	168660711	35	100.0	Internal No-hit

Gene/Protein Characteristic Table for KIAA0814

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information