HUGE

Gene/Protein Characteristic Table for KIAA1916

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00949
Accession No. :	AB067503
Description :	Leucine-rich repeat LGI family member 2 precursor.
HUGO Gene Name :	leucine-rich repeat LGI family, member 2 (LGI2)
Clone Name :	hg01117 [Vector Info]
Flexi ORF Clone :	pF1KSDA1916
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6234 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4604 bp

Genome contig ID gi89161207r_24509569
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TCGGTAAGCCTATGAATAAAAAGTGGTTCATGCCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATATGGTTTTGATCTCTGGTCTGCTTAATATGAATATGGCCACTTGAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 r 24609569 24641405 8 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 542 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAD32305	100.0	LGI1-like prote...	Homo sapiens
Q8N0V4	99.8	Leucine-rich re...	Homo sapiens
XP_001082016	99.3	similar to leuc...	Macaca mulatta
XP_614279	97.0	similar to leuc...	Bos taurus
AAI68885	97.4	Lgi2 protein [R...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011538	2e-17	31.1	KIAA0814
AB011537	1e-13	29.0	KIAA0813
AB018349	1.2e-13	32.8	KIAA0806
AB046800	8.4e-13	31.4	KIAA1580
AB040902	1.3e-12	29.0	KIAA1469

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 132 145 PR00019 Leucine-rich repeat

IPR001611 153 166 PR00019 Leucine-rich repeat

HMMPfam IPR001611 83 105 PF00560 Leucine-rich repeat

IPR001611 107 129 PF00560 Leucine-rich repeat

IPR001611 131 153 PF00560 Leucine-rich repeat

IPR005492 217 257 PF03736 EPTP

IPR005492 405 446 PF03736 EPTP

HMMSmart IPR003591 81 104 SM00369 Leucine-rich repeat

IPR003591 105 128 SM00369 Leucine-rich repeat

IPR003591 129 152 SM00369 Leucine-rich repeat

IPR000483 164 213 SM00082 Cysteine-rich flanking region

ProfileScan IPR009039 215 258 PS50912 EAR

IPR009039 261 304 PS50912 EAR

IPR009039 307 355 PS50912 EAR

IPR009039 356 400 PS50912 EAR

IPR009039 403 447 PS50912 EAR

IPR009039 448 491 PS50912 EAR

IPR009039 494 537 PS50912 EAR

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	132	145	PR00019	Leucine-rich repeat
IPR001611	153	166	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	83	105	PF00560	Leucine-rich repeat
IPR001611	107	129	PF00560	Leucine-rich repeat
IPR001611	131	153	PF00560	Leucine-rich repeat
IPR005492	217	257	PF03736	EPTP
IPR005492	405	446	PF03736	EPTP
HMMSmart	IPR003591	81	104	SM00369	Leucine-rich repeat
IPR003591	105	128	SM00369	Leucine-rich repeat
IPR003591	129	152	SM00369	Leucine-rich repeat
IPR000483	164	213	SM00082	Cysteine-rich flanking region
ProfileScan	IPR009039	215	258	PS50912	EAR
IPR009039	261	304	PS50912	EAR
IPR009039	307	355	PS50912	EAR
IPR009039	356	400	PS50912	EAR
IPR009039	403	447	PS50912	EAR
IPR009039	448	491	PS50912	EAR
IPR009039	494	537	PS50912	EAR

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 6 GALGLLLLLLGAACLIPRSAQV 27 PRIMARY 22

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	6	GALGLLLLLLGAACLIPRSAQV	27	PRIMARY	22

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTCATCAGACTTTACCCTACC

Primer_r
: ATGGACTGACCTGTAATGTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4604 bp
Genome contig ID	gi89161207r_24509569
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TCGGTAAGCCTATGAATAAAAAGTGGTTCATGCCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATATGGTTTTGATCTCTGGTCTGCTTAATATGAATATGGCCACTTGAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	r	24609569	24641405	8	99.1	Perfect prediction

Primer_f	: TTCATCAGACTTTACCCTACC
Primer_r	: ATGGACTGACCTGTAATGTTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1916

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information