HUGE

Gene/Protein Characteristic Table for KIAA1901

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01183
Accession No. :	AB067488
Description :	Serine/threonine-protein kinase Nek1.
HUGO Gene Name :	NIMA (never in mitosis gene a)-related kinase 1 (NEK1)
Clone Name :	hh03635 [Vector Info]
Flexi ORF Clone :	pF1KA1901
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5497 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1228 bp

Genome contig ID gi89161207r_170451006
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
TATTTTATGATATTGCTATTAAATTTTTATTATCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCTGAAGTATATCAATTGTCTTTTATTTATTATTTTACTTTTCTCAATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 r 170551006 170770189 34 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1265 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96PY6	100.0	Serine/threonin...	Homo sapiens
EAX04788	99.6	NIMA (never in ...	Homo sapiens
XP_001153129	99.7	NIMA (never in ...	Pan troglodytes
XP_001082793	97.5	NIMA (never in ...	Macaca mulatta
XP_001915719	88.0	similar to Seri...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB082526	3.9e-22	42.3	KIAA1995
AB033104	2.4e-15	35.9	KIAA1278
AB058763	3.4e-12	30.0	KIAA1860
AB032968	7.4e-12	30.9	KIAA1142
AB018265	1.1e-11	31.0	KIAA0722

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 11 255 PD000001 Protein kinase

HMMPfam IPR000719 11 265 PF00069 Protein kinase

HMMSmart IPR001245 11 264 SM00219 Tyrosine protein kinase

IPR002290 11 265 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 11 265 PS50011 Protein kinase

ScanRegExp IPR000719 17 40 PS00107 Protein kinase

IPR008271 131 143 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	11	255	PD000001	Protein kinase
HMMPfam	IPR000719	11	265	PF00069	Protein kinase
HMMSmart	IPR001245	11	264	SM00219	Tyrosine protein kinase
IPR002290	11	265	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	11	265	PS50011	Protein kinase
ScanRegExp	IPR000719	17	40	PS00107	Protein kinase
IPR008271	131	143	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGATTTACAAGAGCTGCAGGC

Primer_r
: CTTCGTTCAGGGCACTTTCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1228 bp
Genome contig ID	gi89161207r_170451006
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- TATTTTATGATATTGCTATTAAATTTTTATTATCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCTGAAGTATATCAATTGTCTTTTATTTATTATTTTACTTTTCTCAATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	r	170551006	170770189	34	99.8	Perfect prediction

Primer_f	: AGATTTACAAGAGCTGCAGGC
Primer_r	: CTTCGTTCAGGGCACTTTCAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1901

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information