HUGE

Gene/Protein Characteristic Table for KIAA0722

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00613
Accession No. :	AB018265
Description :	Serine/threonine-protein kinase ULK1.
HUGO Gene Name :
Clone Name :	hk02030s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0722
Source :	Human adult brain
Note :	We replaced hk02030, former representative clones for KIAA0722 with hk02030s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4821 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1618 bp

Genome contig ID gi89161190f_130845494
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CGGTGTCCTGGTCCTCTTGCTTCCGTCGCGGCCGC
Flanking genome sequence
(127985 - 128034)
----+----*----+----*----+----*----+----*----+----*
ATGTGCGTGTGTCCAAGCAGGTCCTGGGCGCCTCAACTGCTGCCCCTGGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 130945450 130973477 28 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1066 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O75385	100.0	Serine/threonin...	Homo sapiens
AAI11604	99.9	ULK1 protein [s...	synthetic construct
XP_001928586	90.6	unc-51-like kin...	Sus scrofa
XP_604678	90.2	similar to unc-...	Bos taurus
XP_001105326	97.6	similar to unc-...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014523	1.9e-54	52.4	KIAA0623
AB051552	2e-08	31.5	KIAA1765
AB046859	2.1e-08	25.3	KIAA1639
D43636	2.1e-07	33.1	KIAA0096
AB067488	3.1e-07	31.5	KIAA1901

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 32 293 PD000001 Protein kinase

HMMPfam IPR000719 32 294 PF00069 Protein kinase

HMMSmart IPR001245 32 294 SM00219 Tyrosine protein kinase

IPR002290 32 294 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 32 294 PS50011 Protein kinase

ScanRegExp IPR000719 38 62 PS00107 Protein kinase

IPR008271 150 162 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	32	293	PD000001	Protein kinase
HMMPfam	IPR000719	32	294	PF00069	Protein kinase
HMMSmart	IPR001245	32	294	SM00219	Tyrosine protein kinase
IPR002290	32	294	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	32	294	PS50011	Protein kinase
ScanRegExp	IPR000719	38	62	PS00107	Protein kinase
IPR008271	150	162	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTTGTTCAAGCGTTCCTCTGG

Primer_r
: CCTGTGCCATCTGCCTCTAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTTGTTCAAGCGTTCCTCTGG
Primer_r	: CCTGTGCCATCTGCCTCTAAC
PCR product length	: 209 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1618 bp
Genome contig ID	gi89161190f_130845494
PolyA signal sequence (None)	+--------+--------+----*----+---- CGGTGTCCTGGTCCTCTTGCTTCCGTCGCGGCCGC
Flanking genome sequence (127985 - 128034)	----+--------+--------+--------+--------+----* ATGTGCGTGTGTCCAAGCAGGTCCTGGGCGCCTCAACTGCTGCCCCTGGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	130945450	130973477	28	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0722

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information