HUGE

Gene/Protein Characteristic Table for KIAA1860

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00935
Accession No. :	AB058763
Description :	MAP/microtubule affinity-regulating kinase 4.
HUGO Gene Name :	MAP/microtubule affinity-regulating kinase 4 (MARK4)
Clone Name :	fh18358 [Vector Info]
Flexi ORF Clone :	pF1KSDA1860
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4917 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2845 bp

Genome contig ID gi42406306f_50346682
PolyA signal sequence
(AGTAAA,-18)
+----*----+----*----+----*----+----
TCAACTGGGGACAGTACAGTAAAGAACATCACAGC
Flanking genome sequence
(153701 - 153750)
----+----*----+----*----+----*----+----*----+----*
ATCTCACAGGTTCTGCATACCTTAATGTTTAGAATCTCTCCTAACCTTCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 50446682 50500381 18 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 689 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW57334	0	100.0	MAP/microtubule...	Homo sapiens
BAB39380	0	99.9	MAP/microtubule...	Homo sapiens
Q96L34	1.6e-201	99.2	MAP/microtubule...	Homo sapiens
BAC03375	5.7e-201	99.1	microtubule aff...	Homo sapiens
XP_001057742	5.1e-198	97.2	similar to MAP/...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040910	3.9e-41	54.9	KIAA1477
AB023216	6.8e-32	52.2	KIAA0999
AB018324	9.7e-30	55.8	KIAA0781
AB011109	1.3e-22	33.1	KIAA0537
D43636	5e-22	32.5	KIAA0096

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 60 310 PD000001 Protein kinase

HMMPfam IPR000719 60 311 PF00069 Protein kinase

IPR000449 331 370 PF00627 Ubiquitin-associated/Translation elongation factor EF1B

HMMSmart IPR001245 60 310 SM00219 Tyrosine protein kinase

IPR002290 60 311 SM00220 Serine/threonine protein kinase

IPR000449 332 369 SM00165 Ubiquitin-associated/Translation elongation factor EF1B

ProfileScan IPR000719 60 311 PS50011 Protein kinase

IPR000449 325 369 PS50030 Ubiquitin-associated/Translation elongation factor EF1B

ScanRegExp IPR000719 66 89 PS00107 Protein kinase

IPR008271 178 190 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	60	310	PD000001	Protein kinase
HMMPfam	IPR000719	60	311	PF00069	Protein kinase
IPR000449	331	370	PF00627	Ubiquitin-associated/Translation elongation factor EF1B
HMMSmart	IPR001245	60	310	SM00219	Tyrosine protein kinase
IPR002290	60	311	SM00220	Serine/threonine protein kinase
IPR000449	332	369	SM00165	Ubiquitin-associated/Translation elongation factor EF1B
ProfileScan	IPR000719	60	311	PS50011	Protein kinase
IPR000449	325	369	PS50030	Ubiquitin-associated/Translation elongation factor EF1B
ScanRegExp	IPR000719	66	89	PS00107	Protein kinase
IPR008271	178	190	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCGCAGATAGATTTAAGAGAG

Primer_r
: AGTTGAAGATCCCAGCTCCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2845 bp
Genome contig ID	gi42406306f_50346682
PolyA signal sequence (AGTAAA,-18)	+--------+--------+----*----+---- TCAACTGGGGACAGTACAGTAAAGAACATCACAGC
Flanking genome sequence (153701 - 153750)	----+--------+--------+--------+--------+----* ATCTCACAGGTTCTGCATACCTTAATGTTTAGAATCTCTCCTAACCTTCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	50446682	50500381	18	99.9	Perfect prediction

Primer_f	: GCGCAGATAGATTTAAGAGAG
Primer_r	: AGTTGAAGATCCCAGCTCCAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1860

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information