| HUGE |
Gene/Protein Characteristic Table for KIAA0781 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00636 |
|---|---|
| Accession No. : | AB018324 |
| Description : | Serine/threonine-protein kinase SNF1-like kinase 2. |
| HUGO Gene Name : | SNF1-like kinase 2 (SNF1LK2) |
| Clone Name : | hk09678 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0781
![]() |
| Source : | Human adult brain |
| Note : | We replaced hk05370 and fj04126, former representative clones for KIAA0781 with hk09678. (2001/5/29,2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4160 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1305 bp Genome contig ID gi51511727f_110878424 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
CATTATATTACTAATAAAACTTAACCAACACTTACFlanking genome sequence
(222946 - 222995) ----+----*----+----*----+----*----+----*----+----*
AATTCAGTCATCAAAGTAAGTAAAAATTAGATGCTACAGCTAGCTAACTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 f 110978424 111101368 15 99.5 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 950 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : CCTTATTCTCCACTCAACAGC | |
| : TAGACATCTTTGAGGTGAGCC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 11 |
| : UniGene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |