HUGE |
Gene/Protein Characteristic Table for KIAA0781 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00636 |
---|---|
Accession No. : | AB018324 |
Description : | Serine/threonine-protein kinase SNF1-like kinase 2. |
HUGO Gene Name : | SNF1-like kinase 2 (SNF1LK2) |
Clone Name : | hk09678 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0781
![]() |
Source : | Human adult brain |
Note : | We replaced hk05370 and fj04126, former representative clones for KIAA0781 with hk09678. (2001/5/29,2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4160 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1305 bp Genome contig ID gi51511727f_110878424 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
CATTATATTACTAATAAAACTTAACCAACACTTACFlanking genome sequence
(222946 - 222995) ----+----*----+----*----+----*----+----*----+----*
AATTCAGTCATCAAAGTAAGTAAAAATTAGATGCTACAGCTAGCTAACTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 f 110978424 111101368 15 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 950 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 49 | 295 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 44 | 295 | PF00069 | Protein kinase |
HMMSmart | IPR001245 | 44 | 295 | SM00219 | Tyrosine protein kinase |
IPR002290 | 44 | 295 | SM00220 | Serine/threonine protein kinase | |
ProfileScan | IPR000719 | 44 | 295 | PS50011 | Protein kinase |
IPR000449 | 319 | 359 | PS50030 | Ubiquitin-associated/Translation elongation factor EF1B | |
ScanRegExp | IPR000719 | 50 | 73 | PS00107 | Protein kinase |
IPR008271 | 162 | 174 | PS00108 | Serine/threonine protein kinase |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
SOSUI2 | 1 | 222 | LDIWSMGVVLYVLVCGALPFDGP | 244 | PRIMARY | 23 |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CCTTATTCTCCACTCAACAGC | |
: TAGACATCTTTGAGGTGAGCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 11 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |