HUGE

Gene/Protein Characteristic Table for KIAA1477

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00236
Accession No. :	AB040910
Description :	Serine/threonine-protein kinase MARK1.
HUGO Gene Name :
Clone Name :	fj04927 [Vector Info]
Flexi ORF Clone :	pF1KA1477
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4638 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1764 bp

Genome contig ID gi89161185f_218668191
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
AGTTCTCATAATAAAGCACTTGTCTTTTGCTCTTT
Flanking genome sequence
(235706 - 235755)
----+----*----+----*----+----*----+----*----+----*
ATCAGAATGTGAATTACCTGTTTTCTGGTACAAAAGTATTCTGTATGAGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 218768191 218903895 16 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 870 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG11330	1.9e-209	100.0	serine/threonin...	synthetic construct
CAH72462	4.8e-209	99.9	MAP/microtubule...	Homo sapiens
EAW93298	1.9e-176	97.1	MAP/microtubule...	Homo sapiens
XP_525067	2.1e-175	96.5	MAP/microtubule...	Pan troglodytes
XP_001172814	7.9e-173	95.8	MAP/microtubule...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058763	4.5e-34	54.9	KIAA1860
AB023216	4.9e-18	51.7	KIAA0999
AB018324	5.2e-17	50.6	KIAA0781
AB058714	7.4e-13	32.3	KIAA1811
AB011109	8e-12	29.6	KIAA0537

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 172 401 PD000001 Protein kinase

HMMPfam IPR000719 172 401 PF00069 Protein kinase

IPR000449 421 460 PF00627 Ubiquitin-associated/Translation elongation factor EF1B

IPR001772 821 870 PF02149 Kinase-associated KA1

HMMSmart IPR001245 172 400 SM00219 Tyrosine protein kinase

IPR002290 172 401 SM00220 Serine/threonine protein kinase

IPR000449 422 459 SM00165 Ubiquitin-associated/Translation elongation factor EF1B

ProfileScan IPR000719 172 401 PS50011 Protein kinase

IPR000449 415 460 PS50030 Ubiquitin-associated/Translation elongation factor EF1B

IPR001772 821 870 PS50032 Kinase-associated KA1

ScanRegExp IPR000719 178 201 PS00107 Protein kinase

IPR008271 268 280 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	172	401	PD000001	Protein kinase
HMMPfam	IPR000719	172	401	PF00069	Protein kinase
IPR000449	421	460	PF00627	Ubiquitin-associated/Translation elongation factor EF1B
IPR001772	821	870	PF02149	Kinase-associated KA1
HMMSmart	IPR001245	172	400	SM00219	Tyrosine protein kinase
IPR002290	172	401	SM00220	Serine/threonine protein kinase
IPR000449	422	459	SM00165	Ubiquitin-associated/Translation elongation factor EF1B
ProfileScan	IPR000719	172	401	PS50011	Protein kinase
IPR000449	415	460	PS50030	Ubiquitin-associated/Translation elongation factor EF1B
IPR001772	821	870	PS50032	Kinase-associated KA1
ScanRegExp	IPR000719	178	201	PS00107	Protein kinase
IPR008271	268	280	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAAGACCTCAGGCTAACAGTG

Primer_r
: TATTCCTTCTTGCCATGCTAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CGAGCCAGGCAGTGATTTGAG
Primer_r	: GGTATGCGGACAGTAACGAGG
PCR product length	: 178 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1764 bp
Genome contig ID	gi89161185f_218668191
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- AGTTCTCATAATAAAGCACTTGTCTTTTGCTCTTT
Flanking genome sequence (235706 - 235755)	----+--------+--------+--------+--------+----* ATCAGAATGTGAATTACCTGTTTTCTGGTACAAAAGTATTCTGTATGAGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	218768191	218903895	16	99.5	Perfect prediction

Primer_f	: AAAGACCTCAGGCTAACAGTG
Primer_r	: TATTCCTTCTTGCCATGCTAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1477

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information