HUGE |
Gene/Protein Characteristic Table for KIAA1811 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04289 |
---|---|
Accession No. : | AB058714 |
Description : | BR serine/threonine-protein kinase 1. |
HUGO Gene Name : | BR serine/threonine kinase 1 (BRSK1) |
Clone Name : | ha06731 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2576 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 427 bp Genome contig ID gi42406306f_60390239 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GATTTGCTCTCCGGAAGGAATTCTGGTTTCGCGTGFlanking genome sequence
(125438 - 125487) ----+----*----+----*----+----*----+----*----+----*
ATCCTGCCTGCGTCCGTGTCTCTGATTCCGCCGGCGGCAAAAAAAAAAAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 f 60490239 60515675 18 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 715 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 1 | 221 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 1 | 222 | PF00069 | Protein kinase |
HMMSmart | IPR001245 | 1 | 223 | SM00219 | Tyrosine protein kinase |
IPR002290 | 1 | 222 | SM00220 | Serine/threonine protein kinase | |
ProfileScan | IPR000719 | 1 | 222 | PS50011 | Protein kinase |
IPR000449 | 251 | 293 | PS50030 | Ubiquitin-associated/Translation elongation factor EF1B | |
ScanRegExp | IPR008271 | 89 | 101 | PS00108 | Serine/threonine protein kinase |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
SOSUI2 | 1 | 152 | WSCGVILFALLVGALPFDDDNLR | 174 | PRIMARY | 23 |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCTCAACTCCATCCGCAACAG | |
: GATGCTGCTGAGAGGTTTGTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 19 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |