| HUGE |
Gene/Protein Characteristic Table for KIAA0175 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK05968 |
|---|---|
| Accession No. : | D79997 |
| Description : | Maternal embryonic leucine zipper kinase. |
| HUGO Gene Name : | maternal embryonic leucine zipper kinase (MELK) |
| Clone Name : | ha02337 [Vector Info] |
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 2470 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 344 bp Genome contig ID gi89161216f_36462873 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
TAATTTCTTTCTGAAATAAAACCATTTGTGAATATFlanking genome sequence
(204807 - 204856) ----+----*----+----*----+----*----+----*----+----*
AGCAGGCTTCTCTTTTTTGTATTTGATTTTGATCCAAATAAAACCTCAAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 9 f 36562873 36667678 18 100.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 656 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 9 |
| : Genebridge 4 | |
| : GGATGAGTGTGGGTGTGATAC | |
| : TGACAGATGGGCTTGATTTAG | |
| : 173 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |