| HUGE |
Gene/Protein Characteristic Table for KIAA0246 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK01662 |
|---|---|
| Accession No. : | D87433 |
| Description : | Stabilin-1 precursor. |
| HUGO Gene Name : | stabilin 1 (STAB1) |
| Clone Name : | ef02679 [Vector Info] |
| Flexi ORF Clone : | pF1KA0246
|
| Source : | |
| Note : | We replaced ha04606, former representative clones for KIAA0246 with ef02679. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 7909 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 137 bp Genome contig ID gi89161205f_52404411 PolyA signal sequence
(None)
TAAAGGTGCCCTCAGCGGATGTGGGCCATGTCACCFlanking genome sequence
(129140 - 129189)
AAGGAAGGGGGTCTTCATGCAGCCGGTGCAGAGCTGGTCCATCCAGAGGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 f 52504411 52533549 69 99.9 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 2589 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 3 |
| : Genebridge 4 | |
| : TGATGCTGATGACGACTTCTC | |
| : CAATAAAAGTGGTCTCCTCCC | |
| : 216 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
