HUGE

Gene/Protein Characteristic Table for KIAA1639

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06217
Accession No. :	AB046859
Description :	Obscurin.
HUGO Gene Name :
Clone Name :	af14886 [Vector Info]
Source :	Human brain (amygdala)
Note :	We replaced fj06072, former representative clones for KIAA1639 with af14886. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 7835 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 79 bp

Genome contig ID gi89161185f_226489402
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
GCAGACGCGCCAATAAAAACGCACAGCCGGGCGAG
Flanking genome sequence
(143798 - 143847)
----+----*----+----*----+----*----+----*----+----*
AAGTCTTCCGTCTCGTTGCATTATTTTCTTTTGGGGAGGAGAGGGAGTGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 226589206 226633198 45 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 2584 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001092093	99.9	obscurin, cytos...	Homo sapiens
Q5VST9	99.9	Obscurin; Obscu...	Homo sapiens
CAH71670	99.8	obscurin, cytos...	Homo sapiens
CAJ76912	99.8	obscurin isofor...	Homo sapiens
CAM24490	78.1	obscurin, cytos...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037718	1.7e-11	28.4	KIAA1297
AB018265	1.7e-07	25.2	KIAA0722
AB033104	6e-07	33.5	KIAA1278
AB058763	1.1e-06	26.2	KIAA1860
AB023185	1.8e-06	30.7	KIAA0968

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 1084 1337 PD000001 Protein kinase

IPR000719 2297 2531 PD000001 Protein kinase

HMMPfam IPR013098 1 81 PF07679 Immunoglobulin I-set

IPR000219 312 492 PF00621 DH

IPR001849 512 620 PF00169 Pleckstrin-like

IPR013098 630 722 PF07679 Immunoglobulin I-set

IPR013098 724 815 PF07679 Immunoglobulin I-set

IPR013098 973 1062 PF07679 Immunoglobulin I-set

IPR000719 1084 1337 PF00069 Protein kinase

IPR013098 2079 2169 PF07679 Immunoglobulin I-set

IPR000719 2288 2490 PF00069 Protein kinase

HMMSmart IPR003599 1 82 SM00409 Immunoglobulin subtype

IPR003598 8 71 SM00408 Immunoglobulin subtype 2

IPR000219 312 492 SM00325 DH

IPR001849 512 622 SM00233 Pleckstrin-like

IPR003599 636 723 SM00409 Immunoglobulin subtype

IPR003598 642 710 SM00408 Immunoglobulin subtype 2

IPR003599 730 816 SM00409 Immunoglobulin subtype

IPR003598 736 805 SM00408 Immunoglobulin subtype 2

IPR003599 979 1063 SM00409 Immunoglobulin subtype

IPR003598 985 1052 SM00408 Immunoglobulin subtype 2

IPR001245 1084 1337 SM00219 Tyrosine protein kinase

IPR002290 1084 1337 SM00220 Serine/threonine protein kinase

IPR003599 2085 2171 SM00409 Immunoglobulin subtype

IPR003598 2091 2159 SM00408 Immunoglobulin subtype 2

IPR002290 2288 2540 SM00220 Serine/threonine protein kinase

ProfileScan IPR007110 1 82 PS50835 Immunoglobulin-like

IPR000219 308 493 PS50010 DH

IPR001849 511 620 PS50003 Pleckstrin-like

IPR007110 630 713 PS50835 Immunoglobulin-like

IPR007110 724 816 PS50835 Immunoglobulin-like

IPR007110 973 1061 PS50835 Immunoglobulin-like

IPR000719 1084 1337 PS50011 Protein kinase

IPR007110 2079 2168 PS50835 Immunoglobulin-like

IPR003961 2173 2260 PS50853 Fibronectin

IPR000719 2288 2540 PS50011 Protein kinase

ScanRegExp IPR001547 1061 1070 PS00659 Glycoside hydrolase

IPR000719 1090 1113 PS00107 Protein kinase

IPR008271 1199 1211 PS00108 Serine/threonine protein kinase

IPR008266 2403 2415 PS00109 Tyrosine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	1084	1337	PD000001	Protein kinase
IPR000719	2297	2531	PD000001	Protein kinase
HMMPfam	IPR013098	1	81	PF07679	Immunoglobulin I-set
IPR000219	312	492	PF00621	DH
IPR001849	512	620	PF00169	Pleckstrin-like
IPR013098	630	722	PF07679	Immunoglobulin I-set
IPR013098	724	815	PF07679	Immunoglobulin I-set
IPR013098	973	1062	PF07679	Immunoglobulin I-set
IPR000719	1084	1337	PF00069	Protein kinase
IPR013098	2079	2169	PF07679	Immunoglobulin I-set
IPR000719	2288	2490	PF00069	Protein kinase
HMMSmart	IPR003599	1	82	SM00409	Immunoglobulin subtype
IPR003598	8	71	SM00408	Immunoglobulin subtype 2
IPR000219	312	492	SM00325	DH
IPR001849	512	622	SM00233	Pleckstrin-like
IPR003599	636	723	SM00409	Immunoglobulin subtype
IPR003598	642	710	SM00408	Immunoglobulin subtype 2
IPR003599	730	816	SM00409	Immunoglobulin subtype
IPR003598	736	805	SM00408	Immunoglobulin subtype 2
IPR003599	979	1063	SM00409	Immunoglobulin subtype
IPR003598	985	1052	SM00408	Immunoglobulin subtype 2
IPR001245	1084	1337	SM00219	Tyrosine protein kinase
IPR002290	1084	1337	SM00220	Serine/threonine protein kinase
IPR003599	2085	2171	SM00409	Immunoglobulin subtype
IPR003598	2091	2159	SM00408	Immunoglobulin subtype 2
IPR002290	2288	2540	SM00220	Serine/threonine protein kinase
ProfileScan	IPR007110	1	82	PS50835	Immunoglobulin-like
IPR000219	308	493	PS50010	DH
IPR001849	511	620	PS50003	Pleckstrin-like
IPR007110	630	713	PS50835	Immunoglobulin-like
IPR007110	724	816	PS50835	Immunoglobulin-like
IPR007110	973	1061	PS50835	Immunoglobulin-like
IPR000719	1084	1337	PS50011	Protein kinase
IPR007110	2079	2168	PS50835	Immunoglobulin-like
IPR003961	2173	2260	PS50853	Fibronectin
IPR000719	2288	2540	PS50011	Protein kinase
ScanRegExp	IPR001547	1061	1070	PS00659	Glycoside hydrolase
IPR000719	1090	1113	PS00107	Protein kinase
IPR008271	1199	1211	PS00108	Serine/threonine protein kinase
IPR008266	2403	2415	PS00109	Tyrosine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTTCCTGAAATCCATGCCTGC

Primer_r
: CTTGTAGCTCATCAGGGAACG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: CCR
Primer_f	: ATATCAAGTACCTCCCATTCG
Primer_r	: CTCTGACTCCTCTGTGATCTC
PCR product length	: 176 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	79 bp
Genome contig ID	gi89161185f_226489402
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GCAGACGCGCCAATAAAAACGCACAGCCGGGCGAG
Flanking genome sequence (143798 - 143847)	----+--------+--------+--------+--------+----* AAGTCTTCCGTCTCGTTGCATTATTTTCTTTTGGGGAGGAGAGGGAGTGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	226589206	226633198	45	99.7	Perfect prediction

Primer_f	: GTTCCTGAAATCCATGCCTGC
Primer_r	: CTTGTAGCTCATCAGGGAACG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1639

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information