HUGE

Gene/Protein Characteristic Table for KIAA1297

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06960
Accession No. :	AB037718
Description :	Striated muscle preferentially expressed protein kinase.
HUGO Gene Name :	SPEG complex locus (SPEG)
Clone Name :	fg03883 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 6726 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 0 bp

Genome contig ID gi89161199f_219940202
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
CTGTCTGCCACAAGGAAATAAAAATGGCAAGCAGC
Flanking genome sequence
(126394 - 126443)
----+----*----+----*----+----*----+----*----+----*
ATAACCTGTGTGTCTATTGGGAGGGATGGCTGGAGGGGAAGATGGCTGGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 220040202 220066594 32 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 2242 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAT80901	100.0	striated muscle...	Homo sapiens
EAW70752	99.6	hCG1811882, iso...	Homo sapiens
Q15772	99.7	Striated muscle...	Homo sapiens
EAW70753	99.9	hCG1811882, iso...	Homo sapiens
ACH95326	92.9	SPEG complex lo...	Otolemur garnettii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046859	4.1e-09	28.5	KIAA1639
AB023185	1e-05	31.4	KIAA0968
AB051552	0.00032	24.6	KIAA1765
AB018265	0.00047	24.8	KIAA0722
AB002367	0.00059	30.4	KIAA0369

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 620 873 PD000001 Protein kinase

IPR000719 2036 2231 PD000001 Protein kinase

HMMPfam IPR013151 1 62 PF00047 Immunoglobulin

IPR013098 83 172 PF07679 Immunoglobulin I-set

IPR013098 207 296 PF07679 Immunoglobulin I-set

IPR003961 301 390 PF00041 Fibronectin

IPR013098 409 500 PF07679 Immunoglobulin I-set

IPR013098 504 593 PF07679 Immunoglobulin I-set

IPR000719 620 873 PF00069 Protein kinase

IPR013098 1603 1693 PF07679 Immunoglobulin I-set

IPR003961 1697 1779 PF00041 Fibronectin

IPR000719 1985 2235 PF00069 Protein kinase

HMMSmart IPR003598 1 67 SM00408 Immunoglobulin subtype 2

IPR003599 1 78 SM00409 Immunoglobulin subtype

IPR003599 89 173 SM00409 Immunoglobulin subtype

IPR003598 95 162 SM00408 Immunoglobulin subtype 2

IPR003599 213 297 SM00409 Immunoglobulin subtype

IPR003598 219 286 SM00408 Immunoglobulin subtype 2

IPR003961 301 387 SM00060 Fibronectin

IPR003599 415 501 SM00409 Immunoglobulin subtype

IPR003598 421 490 SM00408 Immunoglobulin subtype 2

IPR003599 510 594 SM00409 Immunoglobulin subtype

IPR003598 516 583 SM00408 Immunoglobulin subtype 2

IPR002290 620 873 SM00220 Serine/threonine protein kinase

IPR003599 1609 1694 SM00409 Immunoglobulin subtype

IPR003598 1615 1683 SM00408 Immunoglobulin subtype 2

IPR003961 1697 1776 SM00060 Fibronectin

IPR001245 1985 2237 SM00219 Tyrosine protein kinase

IPR002290 1985 2237 SM00220 Serine/threonine protein kinase

ProfileScan IPR007110 1 76 PS50835 Immunoglobulin-like

IPR007110 83 171 PS50835 Immunoglobulin-like

IPR007110 207 297 PS50835 Immunoglobulin-like

IPR003961 301 396 PS50853 Fibronectin

IPR007110 504 592 PS50835 Immunoglobulin-like

IPR000719 620 873 PS50011 Protein kinase

IPR007110 1602 1692 PS50835 Immunoglobulin-like

IPR003961 1693 1788 PS50853 Fibronectin

IPR000719 1985 2237 PS50011 Protein kinase

ScanRegExp IPR000719 626 649 PS00107 Protein kinase

IPR008271 734 746 PS00108 Serine/threonine protein kinase

IPR008271 2100 2112 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	620	873	PD000001	Protein kinase
IPR000719	2036	2231	PD000001	Protein kinase
HMMPfam	IPR013151	1	62	PF00047	Immunoglobulin
IPR013098	83	172	PF07679	Immunoglobulin I-set
IPR013098	207	296	PF07679	Immunoglobulin I-set
IPR003961	301	390	PF00041	Fibronectin
IPR013098	409	500	PF07679	Immunoglobulin I-set
IPR013098	504	593	PF07679	Immunoglobulin I-set
IPR000719	620	873	PF00069	Protein kinase
IPR013098	1603	1693	PF07679	Immunoglobulin I-set
IPR003961	1697	1779	PF00041	Fibronectin
IPR000719	1985	2235	PF00069	Protein kinase
HMMSmart	IPR003598	1	67	SM00408	Immunoglobulin subtype 2
IPR003599	1	78	SM00409	Immunoglobulin subtype
IPR003599	89	173	SM00409	Immunoglobulin subtype
IPR003598	95	162	SM00408	Immunoglobulin subtype 2
IPR003599	213	297	SM00409	Immunoglobulin subtype
IPR003598	219	286	SM00408	Immunoglobulin subtype 2
IPR003961	301	387	SM00060	Fibronectin
IPR003599	415	501	SM00409	Immunoglobulin subtype
IPR003598	421	490	SM00408	Immunoglobulin subtype 2
IPR003599	510	594	SM00409	Immunoglobulin subtype
IPR003598	516	583	SM00408	Immunoglobulin subtype 2
IPR002290	620	873	SM00220	Serine/threonine protein kinase
IPR003599	1609	1694	SM00409	Immunoglobulin subtype
IPR003598	1615	1683	SM00408	Immunoglobulin subtype 2
IPR003961	1697	1776	SM00060	Fibronectin
IPR001245	1985	2237	SM00219	Tyrosine protein kinase
IPR002290	1985	2237	SM00220	Serine/threonine protein kinase
ProfileScan	IPR007110	1	76	PS50835	Immunoglobulin-like
IPR007110	83	171	PS50835	Immunoglobulin-like
IPR007110	207	297	PS50835	Immunoglobulin-like
IPR003961	301	396	PS50853	Fibronectin
IPR007110	504	592	PS50835	Immunoglobulin-like
IPR000719	620	873	PS50011	Protein kinase
IPR007110	1602	1692	PS50835	Immunoglobulin-like
IPR003961	1693	1788	PS50853	Fibronectin
IPR000719	1985	2237	PS50011	Protein kinase
ScanRegExp	IPR000719	626	649	PS00107	Protein kinase
IPR008271	734	746	PS00108	Serine/threonine protein kinase
IPR008271	2100	2112	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 797 TDIWPVGVVAFLCLTGISPFVGE 819 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	797	TDIWPVGVVAFLCLTGISPFVGE	819	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAGTGACAGGTTCCGGTATTC

Primer_r
: TTGTCTGGCTTGATGTCTAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGCATCCCCGACTGTTACTAC
Primer_r	: TGAGTACCCCTGACAAAGACC
PCR product length	: 137 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	0 bp
Genome contig ID	gi89161199f_219940202
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CTGTCTGCCACAAGGAAATAAAAATGGCAAGCAGC
Flanking genome sequence (126394 - 126443)	----+--------+--------+--------+--------+----* ATAACCTGTGTGTCTATTGGGAGGGATGGCTGGAGGGGAAGATGGCTGGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	220040202	220066594	32	99.5	Perfect prediction

Primer_f	: CAGTGACAGGTTCCGGTATTC
Primer_r	: TTGTCTGGCTTGATGTCTAGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1297

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information