| HUGE |
Gene/Protein Characteristic Table for KIAA1621 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00256 |
|---|---|
| Accession No. : | AB046841 |
| Description : | Protocadherin beta 16 precursor. |
| HUGO Gene Name : | protocadherin beta 16 (PCDHB16) |
| Clone Name : | hj04505 [Vector Info] |
| Flexi ORF Clone : | pF1KA1621
|
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4998 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1510 bp Genome contig ID gi51511721f_140441164 PolyA signal sequence
(None)
TTTAATTCTGCAAGTTACTTTAAAGCTAATCTAAGFlanking genome sequence
(104996 - 105045)
AAAAAAAAAAACAAATTGCAAAGTATGAGTAAATTAAAGAAAACAATTTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 f 140541164 140546158 1 99.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 787 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : CGCCTGAGATAGTAGTTGCTG | |
| : AGTGCTCTCTCCGTTACCAAG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 5 |
| : CCR | |
| : CGCCTGAGATAGTAGTTGCTG | |
| : AGTGCTCTCTCCGTTACCAAG | |
| : 148 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
