HUGE |
Gene/Protein Characteristic Table for KIAA1773 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01696 |
---|---|
Accession No. : | AB053446 |
Description : | Protocadherin-16 precursor. |
HUGO Gene Name : | dachsous 1 (Drosophila) (DCHS1) |
Clone Name : | hj00752s2 [Vector Info] |
Flexi ORF Clone : | pF1KA1773
![]() |
Source : | Human adult brain |
Note : | We replaced hj00752x1, former representative clones for KIAA1773 with hj00752s2. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 10759 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 452 bp Genome contig ID gi51511727r_6499134 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
CACTCTGGAGCCTTAATAAACTGCAATTTGTATCCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGTCTCCAGCTTTGTTCTATAGGGATGACTGGAAGACACCTGGCAGAGTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 r 6599134 6633661 21 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 3434 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002126 | 226 | 245 | PR00205 | Cadherin |
IPR002126 | 391 | 420 | PR00205 | Cadherin | |
IPR002126 | 463 | 475 | PR00205 | Cadherin | |
IPR002126 | 693 | 712 | PR00205 | Cadherin | |
IPR002126 | 924 | 937 | PR00205 | Cadherin | |
IPR002126 | 1186 | 1212 | PR00205 | Cadherin | |
IPR002126 | 1223 | 1240 | PR00205 | Cadherin | |
HMMPfam | IPR002126 | 183 | 270 | PF00028 | Cadherin |
IPR002126 | 303 | 382 | PF00028 | Cadherin | |
IPR002126 | 396 | 489 | PF00028 | Cadherin | |
IPR002126 | 510 | 599 | PF00028 | Cadherin | |
IPR002126 | 614 | 705 | PF00028 | Cadherin | |
IPR002126 | 719 | 812 | PF00028 | Cadherin | |
IPR002126 | 826 | 917 | PF00028 | Cadherin | |
IPR002126 | 931 | 1021 | PF00028 | Cadherin | |
IPR002126 | 1035 | 1125 | PF00028 | Cadherin | |
IPR002126 | 1141 | 1232 | PF00028 | Cadherin | |
IPR002126 | 1246 | 1338 | PF00028 | Cadherin | |
IPR002126 | 1358 | 1448 | PF00028 | Cadherin | |
IPR002126 | 1473 | 1563 | PF00028 | Cadherin | |
IPR002126 | 1577 | 1673 | PF00028 | Cadherin | |
IPR002126 | 1686 | 1776 | PF00028 | Cadherin | |
IPR002126 | 1790 | 1878 | PF00028 | Cadherin | |
IPR002126 | 1892 | 1982 | PF00028 | Cadherin | |
IPR002126 | 1996 | 2087 | PF00028 | Cadherin | |
IPR002126 | 2119 | 2195 | PF00028 | Cadherin | |
IPR002126 | 2209 | 2298 | PF00028 | Cadherin | |
IPR002126 | 2312 | 2404 | PF00028 | Cadherin | |
IPR002126 | 2417 | 2503 | PF00028 | Cadherin | |
IPR002126 | 2517 | 2609 | PF00028 | Cadherin | |
IPR002126 | 2623 | 2729 | PF00028 | Cadherin | |
IPR002126 | 2743 | 2833 | PF00028 | Cadherin | |
IPR002126 | 2847 | 2940 | PF00028 | Cadherin | |
IPR002126 | 2954 | 3007 | PF00028 | Cadherin | |
HMMSmart | IPR002126 | 200 | 277 | SM00112 | Cadherin |
IPR002126 | 301 | 389 | SM00112 | Cadherin | |
IPR002126 | 413 | 496 | SM00112 | Cadherin | |
IPR002126 | 524 | 606 | SM00112 | Cadherin | |
IPR002126 | 631 | 712 | SM00112 | Cadherin | |
IPR002126 | 736 | 819 | SM00112 | Cadherin | |
IPR002126 | 843 | 924 | SM00112 | Cadherin | |
IPR002126 | 948 | 1028 | SM00112 | Cadherin | |
IPR002126 | 1052 | 1132 | SM00112 | Cadherin | |
IPR002126 | 1158 | 1239 | SM00112 | Cadherin | |
IPR002126 | 1263 | 1345 | SM00112 | Cadherin | |
IPR002126 | 1375 | 1455 | SM00112 | Cadherin | |
IPR002126 | 1487 | 1570 | SM00112 | Cadherin | |
IPR002126 | 1594 | 1680 | SM00112 | Cadherin | |
IPR002126 | 1703 | 1783 | SM00112 | Cadherin | |
IPR002126 | 1807 | 1885 | SM00112 | Cadherin | |
IPR002126 | 1908 | 1989 | SM00112 | Cadherin | |
IPR002126 | 2013 | 2094 | SM00112 | Cadherin | |
IPR002126 | 2122 | 2202 | SM00112 | Cadherin | |
IPR002126 | 2226 | 2305 | SM00112 | Cadherin | |
IPR002126 | 2329 | 2411 | SM00112 | Cadherin | |
IPR002126 | 2434 | 2510 | SM00112 | Cadherin | |
IPR002126 | 2534 | 2616 | SM00112 | Cadherin | |
IPR002126 | 2640 | 2736 | SM00112 | Cadherin | |
IPR002126 | 2760 | 2840 | SM00112 | Cadherin | |
IPR002126 | 2864 | 2947 | SM00112 | Cadherin | |
IPR002126 | 2971 | 3062 | SM00112 | Cadherin | |
ProfileScan | IPR002126 | 179 | 279 | PS50268 | Cadherin |
IPR002126 | 280 | 391 | PS50268 | Cadherin | |
IPR002126 | 392 | 498 | PS50268 | Cadherin | |
IPR002126 | 510 | 608 | PS50268 | Cadherin | |
IPR002126 | 618 | 714 | PS50268 | Cadherin | |
IPR002126 | 715 | 821 | PS50268 | Cadherin | |
IPR002126 | 822 | 926 | PS50268 | Cadherin | |
IPR002126 | 927 | 1030 | PS50268 | Cadherin | |
IPR002126 | 1031 | 1136 | PS50268 | Cadherin | |
IPR002126 | 1137 | 1247 | PS50268 | Cadherin | |
IPR002126 | 1242 | 1347 | PS50268 | Cadherin | |
IPR002126 | 1360 | 1460 | PS50268 | Cadherin | |
IPR002126 | 1469 | 1572 | PS50268 | Cadherin | |
IPR002126 | 1573 | 1682 | PS50268 | Cadherin | |
IPR002126 | 1682 | 1785 | PS50268 | Cadherin | |
IPR002126 | 1786 | 1887 | PS50268 | Cadherin | |
IPR002126 | 1888 | 1991 | PS50268 | Cadherin | |
IPR002126 | 1992 | 2096 | PS50268 | Cadherin | |
IPR002126 | 2119 | 2204 | PS50268 | Cadherin | |
IPR002126 | 2205 | 2307 | PS50268 | Cadherin | |
IPR002126 | 2308 | 2413 | PS50268 | Cadherin | |
IPR002126 | 2413 | 2512 | PS50268 | Cadherin | |
IPR002126 | 2513 | 2618 | PS50268 | Cadherin | |
IPR002126 | 2619 | 2738 | PS50268 | Cadherin | |
IPR002126 | 2739 | 2842 | PS50268 | Cadherin | |
IPR002126 | 2843 | 2949 | PS50268 | Cadherin | |
IPR002126 | 2950 | 3069 | PS50268 | Cadherin | |
ScanRegExp | IPR002126 | 267 | 277 | PS00232 | Cadherin |
IPR002126 | 379 | 389 | PS00232 | Cadherin | |
IPR002126 | 486 | 496 | PS00232 | Cadherin | |
IPR002126 | 596 | 606 | PS00232 | Cadherin | |
IPR002126 | 702 | 712 | PS00232 | Cadherin | |
IPR002126 | 809 | 819 | PS00232 | Cadherin | |
IPR002126 | 1018 | 1028 | PS00232 | Cadherin | |
IPR002126 | 1335 | 1345 | PS00232 | Cadherin | |
IPR002126 | 1670 | 1680 | PS00232 | Cadherin | |
IPR002126 | 1875 | 1885 | PS00232 | Cadherin | |
IPR002126 | 1979 | 1989 | PS00232 | Cadherin | |
IPR002126 | 2084 | 2094 | PS00232 | Cadherin | |
IPR002126 | 2295 | 2305 | PS00232 | Cadherin | |
IPR002126 | 2401 | 2411 | PS00232 | Cadherin | |
IPR002126 | 2500 | 2510 | PS00232 | Cadherin | |
IPR002126 | 2606 | 2616 | PS00232 | Cadherin | |
IPR002126 | 2726 | 2736 | PS00232 | Cadherin | |
IPR002126 | 2830 | 2840 | PS00232 | Cadherin |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
SOSUI2 | 1 | 154 | RPHLLLPLLLLLLLLLGAGVPGA | 176 | PRIMARY | 23 |
2 | 199 | DISAGLPAGTAAPLMYFISAQE | 220 | SECONDARY | 22 | |
3 | 3074 | VGAVAASLGVVVVLALAALVLGL | 3096 | PRIMARY | 23 |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ACCCTGAGATGGAGCTGAGAC | |
: CAGTTTATTAAGGCTCCAGAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 11 |
: GeneBridge 4 | |
: GCTGTGGAGGATGAGAATGAC | |
: CGAAGCATGGTAAGGGTCTGG | |
: 101 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |