HUGE

Gene/Protein Characteristic Table for KIAA1410

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00827
Accession No. :	AB037831
Description :	dynein, axonemal, heavy chain 1.
HUGO Gene Name :
Clone Name :	pg00933y4 [Vector Info]
Flexi ORF Clone :	pF1KSDA1410
Source :	Human brain (hippocampus)
Note :	We replaced fh06675 and pg00933y2, former representative clones for KIAA1410 with pg00933y4. (2003/4/2,2008/8/27)

Features of the cloned DNA sequence	Description

Length: 13104 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 45 bp

Genome contig ID gi89161205f_52225375
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
AAGGGCTGGGGCCATTAAAGCTGAATTTTCTAAGC
Flanking genome sequence
(184174 - 184223)
----+----*----+----*----+----*----+----*----+----*
AGTCCAGCTGTGCCTTAGCTGCTTGCATGAGGACCCCTCTGCAGGACTCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 52325375 52409547 78 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 4293 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_056327	100.0	dynein, axonema...	Homo sapiens
Q9P2D7	98.5	Dynein heavy ch...	Homo sapiens
EAW65217	96.9	dynein, axonema...	Homo sapiens
XP_001085984	97.0	similar to dyne...	Macaca mulatta
EAW65219	95.7	dynein, axonema...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023161	0	44.1	KIAA0944
AB046823	1.1e-136	34.9	KIAA1603
AB040936	3.1e-80	38.6	KIAA1503
AB051484	2.3e-67	41.5	KIAA1697
AB082528	5e-63	26.0	KIAA1997

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013602 1039 1449 PF08393 Dynein heavy chain

IPR011704 1885 2039 PF07728 ATPase associated with various cellular activities

IPR011704 2250 2397 PF07728 ATPase associated with various cellular activities

IPR004273 3582 4290 PF03028 Dynein heavy chain

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013602	1039	1449	PF08393	Dynein heavy chain
IPR011704	1885	2039	PF07728	ATPase associated with various cellular activities
IPR011704	2250	2397	PF07728	ATPase associated with various cellular activities
IPR004273	3582	4290	PF03028	Dynein heavy chain

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATCGAGGTGCTGTCTGTGGTG
Primer_r	: AGATTGTCAGGCAGCTCCGTG
PCR product length	: 173(800) bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	45 bp
Genome contig ID	gi89161205f_52225375
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- AAGGGCTGGGGCCATTAAAGCTGAATTTTCTAAGC
Flanking genome sequence (184174 - 184223)	----+--------+--------+--------+--------+----* AGTCCAGCTGTGCCTTAGCTGCTTGCATGAGGACCCCTCTGCAGGACTCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	52325375	52409547	78	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1410

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information