HUGE

Gene/Protein Characteristic Table for KIAA1997

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK04848
Accession No. :	AB082528
Description :	dynein, cytoplasmic 2, heavy chain 1.
HUGO Gene Name :
Clone Name :	bj00195y1 [Vector Info]
Flexi ORF Clone :	pF1KA1997
Source :	Human adult brain
Note :	We replaced bj00195, former representative clones for KIAA1997 with bj00195y1. (2003/4/2)

Features of the cloned DNA sequence	Description

Length: 5429 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 370 bp

Genome contig ID gi51511727f_102475193
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TGTCATAATTATTTAATAAAAGAGCATTCATAATT
Flanking genome sequence
(380370 - 380419)
----+----*----+----*----+----*----+----*----+----*
TTTGCAGTCTTCCCATGACTCTTTTTACATACTGAAGAATGTATTATAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 f 102575193 102855561 41 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1685 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG06721	100.0	DYNC2H1 variant...	Homo sapiens
Q8NCM8	99.9	Cytoplasmic dyn...	Homo sapiens
NP_001073932	99.5	dynein, cytopla...	Homo sapiens
CAD98012	99.4	hypothetical pr...	Homo sapiens
EDL24928	94.4	dynein cytoplas...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040936	1.4e-97	27.6	KIAA1503
AB095937	6.6e-94	28.1	KIAA2017
AB023161	2.1e-75	27.8	KIAA0944
AB002323	1.6e-70	28.3	KIAA0325
AB037831	4.3e-68	26.0	KIAA1410

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004273 985 1683 PF03028 Dynein heavy chain

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004273	985	1683	PF03028	Dynein heavy chain

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	370 bp
Genome contig ID	gi51511727f_102475193
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGTCATAATTATTTAATAAAAGAGCATTCATAATT
Flanking genome sequence (380370 - 380419)	----+--------+--------+--------+--------+----* TTTGCAGTCTTCCCATGACTCTTTTTACATACTGAAGAATGTATTATAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	f	102575193	102855561	41	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA1997

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information