HUGE

Gene/Protein Characteristic Table for KIAA1603

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK04798
Accession No. :	AB046823
Description :	Ciliary dynein heavy chain 5.
HUGO Gene Name :
Clone Name :	fj10308y1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fj10308, former representative clones for KIAA1603 with fj10308y1. (2003/4/2)

Features of the cloned DNA sequence	Description

Length: 6104 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1123 bp

Genome contig ID gi51511721r_13643970
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AATTATAGTTGGCTTGAAAAAATGTGATGATCAGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGAAAAAATAAAAAAAGGGTAGAAATATTAGACGGTGCGTAGGGACTTTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 r 13743970 13833994 27 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1659 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG06718	100.0	DNAH5 variant p...	Homo sapiens
EAX08050	100.0	dynein, axonema...	Homo sapiens
Q8TE73	99.9	Dynein heavy ch...	Homo sapiens
XP_001500013	95.7	similar to Dyne...	Equus caballus
XP_848572	94.6	similar to dyne...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037831	3.1e-170	34.9	KIAA1410
AB023161	5e-165	35.0	KIAA0944
AB040936	1.2e-144	37.0	KIAA1503
AB095937	5.3e-112	35.6	KIAA2017
AB002355	6e-95	32.8	KIAA0357

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004273 962 1657 PF03028 Dynein heavy chain

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004273	962	1657	PF03028	Dynein heavy chain

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: RH-map
Primer_f	: CTGCATAGGTTTTCCCCACTC
Primer_r	: TACTACTGTGGATTTGAGGGC
PCR product length	: 156 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1123 bp
Genome contig ID	gi51511721r_13643970
PolyA signal sequence (None)	+--------+--------+----*----+---- AATTATAGTTGGCTTGAAAAAATGTGATGATCAGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAAAAAATAAAAAAAGGGTAGAAATATTAGACGGTGCGTAGGGACTTTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	r	13743970	13833994	27	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA1603

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information