| HUGE |
Gene/Protein Characteristic Table for KIAA0762 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK06967 |
|---|---|
| Accession No. : | AB018305 |
| Description : | Spondin-1 precursor. |
| HUGO Gene Name : | spondin 1, extracellular matrix protein (SPON1) |
| Clone Name : | hk04668s1 [Vector Info] |
| Source : | Human adult brain |
| Note : | We replaced hk04668, former representative clones for KIAA0762 with hk04668s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4301 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2124 bp Genome contig ID gi51511727f_13860979 PolyA signal sequence
(AATAAA,-26) +----*----+----*----+----*----+----
CATTTTGGAAATAAAGATTTTTTACTACAAAAATGFlanking genome sequence
(384956 - 385005) ----+----*----+----*----+----*----+----*----+----*
AAATTTGTTTGGACTTCCACTTGAGACAGTAAAGAGAGTATTAGACACCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 f 13960979 14245933 15 100.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 724 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : GCAATGTTGTTCTAAGCTATC | |
| : AACAATCCAACAAGAGTCATG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 11 |
| : GeneBridge 4 | |
| : GCAATGTTGTTCTAAGCTATC | |
| : AACAATCCAACAAGAGTCATG | |
| : 202 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |