HUGE

Gene/Protein Characteristic Table for KIAA1293

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence

Product ID :	ORK00799
Accession No. :	D14697
Description :	Farnesyl pyrophosphate synthetase.
HUGO Gene Name :
Clone Name :	ha00701 [Vector Info]
Flexi ORF Clone :	pF1KSDA1293
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 1430 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 56 bp

Genome contig ID gi89161185f_153445379
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GAGAGGAGGCTCTCAATAAATAATCGTGTAACCTT
Flanking genome sequence
(111703 - 111752)
----+----*----+----*----+----*----+----*----+----*
CTTGTGGTTCTGTTCTTGCTCGGCCCAGCCAGAGTCTGGCTCTTTCCAGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 153545379 153557080 11 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 420 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P14324	4.3e-189	100.0	Farnesyl pyroph...	Homo sapiens
CAH91070	1.1e-185	98.1	hypothetical pr...	Pongo abelii
XP_001116071	1.1e-184	97.4	farnesyl diphos...	Macaca mulatta
XP_001929119	1.5e-168	87.4	similar to FDPS...	Sus scrofa
XP_537252	1e-166	87.1	similar to farn...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000092 111 383 PF00348 Polyprenyl synthetase

ScanRegExp IPR000092 167 181 PS00723 Polyprenyl synthetase

IPR000092 302 314 PS00444 Polyprenyl synthetase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000092	111	383	PF00348	Polyprenyl synthetase
ScanRegExp	IPR000092	167	181	PS00723	Polyprenyl synthetase
IPR000092	302	314	PS00444	Polyprenyl synthetase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	56 bp
Genome contig ID	gi89161185f_153445379
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GAGAGGAGGCTCTCAATAAATAATCGTGTAACCTT
Flanking genome sequence (111703 - 111752)	----+--------+--------+--------+--------+----* CTTGTGGTTCTGTTCTTGCTCGGCCCAGCCAGAGTCTGGCTCTTTCCAGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	153545379	153557080	11	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1293

Features of the cloned DNA sequence

Features of the protein sequence