ROUGE |
Gene/Protein Characteristic Table for mKIAA1293 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | BC048497 |
---|---|
farnesyl diphosphate synthetase. | |
mbk00773 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1187 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 54 bp Genome contig ID gi65492966r_88737454 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
GGGAGGGAGGGGGTCTCAATAAATTATTGTTCAACFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATCCTGTGGTTTTATTCTTGTGGCAGTCAGGAGTTCAGCTTTATCCAGAA
KIAA Alignment based on: KIAA1293 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..1133
Length: 376 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |