HUGE |
Gene/Protein Characteristic Table for KIAA1075 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00732 |
---|---|
Accession No. : | AB028998 |
Description : | Tensin-like C1 domain-containing phosphatase. |
HUGO Gene Name : | tensin like C1 domain containing phosphatase (tensin 2) (TENC1) |
Clone Name : | hj06716s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1075
![]() |
Source : | Human adult brain |
Note : | We replaced hj06716, former representative clones for KIAA1075 with hj06716s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5009 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 489 bp Genome contig ID gi89161190f_51629947 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
TTTTTGTCTAATAATAAAGAATTTCTATAAACTTTFlanking genome sequence
(114477 - 114526) ----+----*----+----*----+----*----+----*----+----*
AGCCGAAATTGGAGTCAACACTTATTCACAGGAAGGTCAAAGCCTCATCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 f 51729947 51744422 29 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1505 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000980 | 1236 | 1340 | PD000093 | SH2 motif |
HMMPfam | IPR002219 | 128 | 178 | PF00130 | Protein kinase C |
IPR000980 | 1236 | 1328 | PF00017 | SH2 motif | |
IPR013625 | 1371 | 1504 | PF08416 | Tensin phosphotyrosine-binding domain | |
HMMSmart | IPR002219 | 128 | 175 | SM00109 | Protein kinase C |
IPR000980 | 1234 | 1334 | SM00252 | SH2 motif | |
IPR006020 | 1367 | 1505 | SM00462 | Phosphotyrosine interaction region | |
ProfileScan | IPR002219 | 127 | 175 | PS50081 | Protein kinase C |
IPR014019 | 218 | 390 | PS51181 | Phosphatase tensin type | |
IPR014020 | 395 | 521 | PS51182 | C2 tensin-type | |
IPR000980 | 1236 | 1347 | PS50001 | SH2 motif | |
ScanRegExp | IPR002219 | 128 | 175 | PS00479 | Protein kinase C |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCCTACTCTGAATCTCTGCTC | |
: AGTTGAGCCCCGAAGGAGATC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 12 |
: GeneBridge 4 | |
: AGTTGAGCCCCGAAGGAGATC | |
: TCCTACTCTGAATCTCTGCTC | |
: 167 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |