HUGE

Gene/Protein Characteristic Table for KIAA1075

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00732
Accession No. :	AB028998
Description :	Tensin-like C1 domain-containing phosphatase.
HUGO Gene Name :	tensin like C1 domain containing phosphatase (tensin 2) (TENC1)
Clone Name :	hj06716s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1075
Source :	Human adult brain
Note :	We replaced hj06716, former representative clones for KIAA1075 with hj06716s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5009 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 489 bp

Genome contig ID gi89161190f_51629947
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TTTTTGTCTAATAATAAAGAATTTCTATAAACTTT
Flanking genome sequence
(114477 - 114526)
----+----*----+----*----+----*----+----*----+----*
AGCCGAAATTGGAGTCAACACTTATTCACAGGAAGGTCAAAGCCTCATCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 51729947 51744422 29 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1505 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_509087	99.5	tensin like C1 ...	Pan troglodytes
AAM74225	100.0	C1 domain-conta...	Homo sapiens
Q63HR2	99.9	Tensin-like C1 ...	Homo sapiens
AAN03866	99.2	C1 domain-conta...	Homo sapiens
NP_056134	99.1	tensin like C1 ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007942	3.7e-05	25.2	KIAA0473

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000980 1236 1340 PD000093 SH2 motif

HMMPfam IPR002219 128 178 PF00130 Protein kinase C

IPR000980 1236 1328 PF00017 SH2 motif

IPR013625 1371 1504 PF08416 Tensin phosphotyrosine-binding domain

HMMSmart IPR002219 128 175 SM00109 Protein kinase C

IPR000980 1234 1334 SM00252 SH2 motif

IPR006020 1367 1505 SM00462 Phosphotyrosine interaction region

ProfileScan IPR002219 127 175 PS50081 Protein kinase C

IPR014019 218 390 PS51181 Phosphatase tensin type

IPR014020 395 521 PS51182 C2 tensin-type

IPR000980 1236 1347 PS50001 SH2 motif

ScanRegExp IPR002219 128 175 PS00479 Protein kinase C

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000980	1236	1340	PD000093	SH2 motif
HMMPfam	IPR002219	128	178	PF00130	Protein kinase C
IPR000980	1236	1328	PF00017	SH2 motif
IPR013625	1371	1504	PF08416	Tensin phosphotyrosine-binding domain
HMMSmart	IPR002219	128	175	SM00109	Protein kinase C
IPR000980	1234	1334	SM00252	SH2 motif
IPR006020	1367	1505	SM00462	Phosphotyrosine interaction region
ProfileScan	IPR002219	127	175	PS50081	Protein kinase C
IPR014019	218	390	PS51181	Phosphatase tensin type
IPR014020	395	521	PS51182	C2 tensin-type
IPR000980	1236	1347	PS50001	SH2 motif
ScanRegExp	IPR002219	128	175	PS00479	Protein kinase C

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCCTACTCTGAATCTCTGCTC

Primer_r
: AGTTGAGCCCCGAAGGAGATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGTTGAGCCCCGAAGGAGATC
Primer_r	: TCCTACTCTGAATCTCTGCTC
PCR product length	: 167 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	489 bp
Genome contig ID	gi89161190f_51629947
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTTTTGTCTAATAATAAAGAATTTCTATAAACTTT
Flanking genome sequence (114477 - 114526)	----+--------+--------+--------+--------+----* AGCCGAAATTGGAGTCAACACTTATTCACAGGAAGGTCAAAGCCTCATCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	51729947	51744422	29	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1075

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information