ROUGE

Gene/Protein Characteristic Table for mKIAA1075

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC042190
Description :	C1 domain-containing phosphatase and tensin-like protein. tensin 2.
Clone Name :	mie28040 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 938 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 397 bp

Genome contig ID gi65543215f_102073644
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
GAGTCTATTTTTGTGTAATAATAAAGAATTTCTAT
Flanking genome sequence
(102112 - 102161)
----+----*----+----*----+----*----+----*----+----*
AAACTTTTGAGGAGTTGATACCTTCTTCATAGGAAGAAGAAAAAAAAAGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1075 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1075	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..541
Length: 179 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH25818	8.5e-74	100.0	Tenc1 protein [...	Mus musculus
AAN32753	1.6e-73	100.0	tensin 2 [Mus m...	Mus musculus
Q8CGB6	1.6e-73	100.0	Tensin-like C1 ...	Mus musculus
EDL04009	1.6e-73	100.0	tensin like C1 ...	Mus musculus
EDL04008	1.6e-73	100.0	tensin like C1 ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR006020 41 179 SM00462 Phosphotyrosine interaction region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR006020	41	179	SM00462	Phosphotyrosine interaction region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	397 bp
Genome contig ID	gi65543215f_102073644
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- GAGTCTATTTTTGTGTAATAATAAAGAATTTCTAT
Flanking genome sequence (102112 - 102161)	----+--------+--------+--------+--------+----* AAACTTTTGAGGAGTTGATACCTTCTTCATAGGAAGAAGAAAAAAAAAGT

Gene/Protein Characteristic Table for mKIAA1075

Features of the cloned DNA sequence

Features of the protein sequence