HUGE

Gene/Protein Characteristic Table for KIAA0473

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00085
Accession No. :	AB007942
Description :	Putative tyrosine-protein phosphatase auxilin.
HUGO Gene Name :	DnaJ (Hsp40) homolog, subfamily C, member 6 (DNAJC6)
Clone Name :	hh00220 [Vector Info]
Flexi ORF Clone :	pF1KA0473
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5747 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2848 bp

Genome contig ID gi89161185f_65403025
PolyA signal sequence
(AATAAA,-30)
+----*----+----*----+----*----+----
GCTAAAATAAATGTAGCATCTAATTTTATCAGTTT
Flanking genome sequence
(251117 - 251166)
----+----*----+----*----+----*----+----*----+----*
AACATCTGATATGTCTTCTATCCATGTACAATATTTTAAATGGATTTTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 65503025 65654140 19 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 937 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O75061	100.0	Putative tyrosi...	Homo sapiens
XP_001161700	99.6	DnaJ (Hsp40) ho...	Pan troglodytes
XP_001090170	99.6	similar to DnaJ...	Macaca mulatta
CAI18999	98.7	DnaJ (Hsp40) ho...	Homo sapiens
XP_001161657	98.3	DnaJ (Hsp40) ho...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028998	5.9e-07	25.7	KIAA1075

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001623 885 926 PF00226 Heat shock protein DnaJ

HMMSmart IPR001623 872 933 SM00271 Heat shock protein DnaJ

ProfileScan IPR014019 79 246 PS51181 Phosphatase tensin type

IPR000387 163 234 PS50056 Protein-tyrosine phosphatase

IPR014020 252 390 PS51182 C2 tensin-type

IPR001623 873 937 PS50076 Heat shock protein DnaJ

ScanRegExp IPR000387 186 198 PS00383 Protein-tyrosine phosphatase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001623	885	926	PF00226	Heat shock protein DnaJ
HMMSmart	IPR001623	872	933	SM00271	Heat shock protein DnaJ
ProfileScan	IPR014019	79	246	PS51181	Phosphatase tensin type
IPR000387	163	234	PS50056	Protein-tyrosine phosphatase
IPR014020	252	390	PS51182	C2 tensin-type
IPR001623	873	937	PS50076	Heat shock protein DnaJ
ScanRegExp	IPR000387	186	198	PS00383	Protein-tyrosine phosphatase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 190 DGRAASSILVGAMFIFCNLYSTP 212 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	190	DGRAASSILVGAMFIFCNLYSTP	212	PRIMARY	23

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTGCTCATTCCCTACACAGAC
Primer_r	: GATTGAACCTGGAAGTCTGGG
PCR product length	: 183 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2848 bp
Genome contig ID	gi89161185f_65403025
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- GCTAAAATAAATGTAGCATCTAATTTTATCAGTTT
Flanking genome sequence (251117 - 251166)	----+--------+--------+--------+--------+----* AACATCTGATATGTCTTCTATCCATGTACAATATTTTAAATGGATTTTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	65503025	65654140	19	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0473

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information