HUGE

Gene/Protein Characteristic Table for KIAA0890

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01131
Accession No. :	AB020697
Description :	Putative ATP-dependent RNA helicase DHX30.
HUGO Gene Name :	DEAH (Asp-Glu-Ala-His) box polypeptide 30 (DHX30)
Clone Name :	hk08057 [Vector Info]
Flexi ORF Clone :	pF1KA0890
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3800 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 72 bp

Genome contig ID gi89161205f_47721817
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
GTTTATTTAAAATAAAGTTCTATTTATCCCTTGTG
Flanking genome sequence
(144871 - 144920)
----+----*----+----*----+----*----+----*----+----*
ACCACTGCTGTCCACTAGGGGCTCCTCTCTCAGGGCCTCCATACACTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 47819686 47866686 22 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1210 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q7L2E3	100.0	Putative ATP-de...	Homo sapiens
ABM85195	99.9	DEAH (Asp-Glu-A...	synthetic construct
XP_001113204	99.6	similar to DEAH...	Macaca mulatta
Q5R607	99.6	Putative ATP-de...	Pongo abelii
NP_001125306	99.6	DEAH (Asp-Glu-A...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040921	4.3e-44	36.5	KIAA1488
AB011149	3.3e-20	29.1	KIAA0577
D86977	1.3e-19	30.1	KIAA0224
D50924	1.1e-18	30.7	KIAA0134
AB040950	2.4e-12	27.8	KIAA1517

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001159 69 137 PF00035 Double-stranded RNA binding

IPR011545 453 616 PF00270 DNA/RNA helicase

IPR001650 709 803 PF00271 DNA/RNA helicase

IPR007502 866 956 PF04408 Helicase-associated region

IPR011709 996 1123 PF07717 Domain of unknown function DUF1605

HMMSmart IPR014001 448 637 SM00487 DEAD-like helicases

IPR001650 698 803 SM00490 DNA/RNA helicase

ProfileScan IPR014021 460 628 PS51192 Helicase

IPR001650 670 843 PS51194 DNA/RNA helicase

ScanRegExp IPR002464 570 579 PS00690 DNA/RNA helicase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001159	69	137	PF00035	Double-stranded RNA binding
IPR011545	453	616	PF00270	DNA/RNA helicase
IPR001650	709	803	PF00271	DNA/RNA helicase
IPR007502	866	956	PF04408	Helicase-associated region
IPR011709	996	1123	PF07717	Domain of unknown function DUF1605
HMMSmart	IPR014001	448	637	SM00487	DEAD-like helicases
IPR001650	698	803	SM00490	DNA/RNA helicase
ProfileScan	IPR014021	460	628	PS51192	Helicase
IPR001650	670	843	PS51194	DNA/RNA helicase
ScanRegExp	IPR002464	570	579	PS00690	DNA/RNA helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 901 KAIVLAAIFRCLHPLLVVVSCLT 923 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	901	KAIVLAAIFRCLHPLLVVVSCLT	923	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AACATCCTGCTGCACAAGTCG

Primer_r
: ACGAAGACGCTGCCATTGGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AACATCCTGCTGCACAAGTCG
Primer_r	: ACGAAGACGCTGCCATTGGAC
PCR product length	: 104 (0.2k) bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	72 bp
Genome contig ID	gi89161205f_47721817
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GTTTATTTAAAATAAAGTTCTATTTATCCCTTGTG
Flanking genome sequence (144871 - 144920)	----+--------+--------+--------+--------+----* ACCACTGCTGTCCACTAGGGGCTCCTCTCTCAGGGCCTCCATACACTGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	47819686	47866686	22	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0890

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information