HUGE

Gene/Protein Characteristic Table for KIAA0577

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01095
Accession No. :	AB011149
Description :	YTH domain-containing protein 1.
HUGO Gene Name :
Clone Name :	hj00291 [Vector Info]
Flexi ORF Clone :	pF1KA0577
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5134 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1043 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60231	100.0	Putative pre-mR...	Homo sapiens
CAI41883	99.9	DEAH (Asp-Glu-A...	Homo sapiens
AAH08825	99.9	DEAH (Asp-Glu-A...	Homo sapiens
ABM86832	99.8	DEAH (Asp-Glu-A...	synthetic construct
Q7YR39	99.6	Putative pre-mR...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D86977	2.7e-66	40.7	KIAA0224
AB040921	2e-15	32.4	KIAA1488
D50924	2.2e-14	31.9	KIAA0134
AB020697	3.3e-11	29.1	KIAA0890
AB040950	3.4e-10	32.6	KIAA1517

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001650 638 732 PF00271 DNA/RNA helicase

IPR007502 793 884 PF04408 Helicase-associated region

IPR011709 918 1017 PF07717 Domain of unknown function DUF1605

HMMSmart IPR014001 399 584 SM00487 DEAD-like helicases

IPR001650 635 732 SM00490 DNA/RNA helicase

ProfileScan IPR014021 411 575 PS51192 Helicase

IPR001650 600 773 PS51194 DNA/RNA helicase

ScanRegExp IPR002464 517 526 PS00690 DNA/RNA helicase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001650	638	732	PF00271	DNA/RNA helicase
IPR007502	793	884	PF04408	Helicase-associated region
IPR011709	918	1017	PF07717	Domain of unknown function DUF1605
HMMSmart	IPR014001	399	584	SM00487	DEAD-like helicases
IPR001650	635	732	SM00490	DNA/RNA helicase
ProfileScan	IPR014021	411	575	PS51192	Helicase
IPR001650	600	773	PS51194	DNA/RNA helicase
ScanRegExp	IPR002464	517	526	PS00690	DNA/RNA helicase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CTGCTCTACCACGAACTTGTC

Primer_r
: GTCCTTCTCTTACCCTAGCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTGCTCTACCACGAACTTGTC
Primer_r	: GTCCTTCTCTTACCCTAGCTC
PCR product length	: 186 (1.5k) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0577

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information