HUGE |
Gene/Protein Characteristic Table for KIAA1517 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | |
---|---|
Accession No. : | AB040950 |
Description : | Probable ATP-dependent RNA helicase DHX37. |
HUGO Gene Name : | DEAH (Asp-Glu-Ala-His) box polypeptide 37 (DHX37) |
Clone Name : | fh11426 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5421 bp
![]() |
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
cloned DNA seq. | ||
Warning for N-terminal truncation: | YES | YES |
Warning for coding interruption: | YES | NO |
Length of 3'UTR 1113 bp Genome contig ID gi89161190r_123897330 PolyA signal sequence
(AATAAA,-17) +----*----+----*----+----*----+----
CGGTGGAGACAGTTATGGAATAAAATGTTCCTTGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACCCAGATTGTGTTGTGGAATGCACTTGGGGAAGGACACCCAGGTGGCCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 r 123997330 124031197 23 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 998 aa
This protein sequence is predicted from the revised DNA sequence
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001650 | 408 | 499 | PF00271 | DNA/RNA helicase |
IPR007502 | 559 | 682 | PF04408 | Helicase-associated region | |
IPR011709 | 716 | 834 | PF07717 | Domain of unknown function DUF1605 | |
HMMSmart | IPR014001 | 74 | 265 | SM00487 | DEAD-like helicases |
IPR001650 | 380 | 499 | SM00490 | DNA/RNA helicase | |
ProfileScan | IPR014021 | 85 | 252 | PS51192 | Helicase |
IPR001650 | 282 | 539 | PS51194 | DNA/RNA helicase |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AGGTCCCCCAGCAAGAAAGAG | |
: CATAACTGTCTCCACCGAAGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 12 |
: GeneBridge 4 | |
: AGGTCCCCCAGCAAGAAAGAG | |
: CATAACTGTCTCCACCGAAGC | |
: 174 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |