HUGE

Gene/Protein Characteristic Table for KIAA0815

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK05965
Accession No. :	AB011539
Description :	Multiple epidermal growth factor-like domains 6 precursor.
HUGO Gene Name :
Clone Name :	sh06087 [Vector Info]
Flexi ORF Clone :	pF1KA0815
Source :
Note :	We replaced hg01805 and hj06848, former representative clones for KIAA0815 with sh06087. (2002/4/24,2005/08/06)

Features of the cloned DNA sequence	Description

Length: 5456 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 531 bp

Genome contig ID gi89161185r_3296350
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GTACCATGTAAACCTAGGAAGGTAAAGGAGCAGGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACCTCCTCGTGGCCTGTGTGTTTGCTGTGTTACGTGGACTCTGTGTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 3396350 3517919 37 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1640 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE19678	100.0	hypothetical pr...	Homo sapiens
AAI46387	99.7	Multiple EGF-li...	synthetic construct
XP_873582	82.0	similar to EGF-...	Bos taurus
XP_001915428	81.9	multiple EGF-li...	Equus caballus
CAM21839	77.3	multiple EGF-li...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058677	4.8e-91	43.2	KIAA1781
AB058676	2.4e-86	42.5	KIAA1780
AB053450	5.7e-39	28.8	KIAA1776
D63483	1.3e-26	37.4	KIAA0149
AB067494	2.5e-21	32.2	KIAA1907

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002049 651 669 PR00011 EGF-like

IPR002049 739 757 PR00011 EGF-like

IPR002049 870 888 PR00011 EGF-like

HMMPfam IPR011489 133 193 PF07546 EMI

IPR006209 203 233 PF00008 EGF-like

IPR013091 236 275 PF07645 EGF calcium-binding

IPR006209 281 317 PF00008 EGF-like

IPR006209 323 358 PF00008 EGF-like

IPR013091 360 399 PF07645 EGF calcium-binding

IPR006209 410 445 PF00008 EGF-like

IPR013091 487 526 PF07645 EGF calcium-binding

IPR013111 643 669 PF07974 EGF

IPR013111 686 712 PF07974 EGF

IPR002049 866 907 PF00053 EGF-like

IPR002049 948 988 PF00053 EGF-like

IPR002049 992 1035 PF00053 EGF-like

IPR013111 1078 1104 PF07974 EGF

IPR013111 1121 1147 PF07974 EGF

IPR006209 1160 1190 PF00008 EGF-like

IPR002049 1207 1246 PF00053 EGF-like

IPR002049 1250 1290 PF00053 EGF-like

IPR013111 1294 1320 PF07974 EGF

IPR002049 1337 1365 PF00053 EGF-like

IPR002049 1423 1462 PF00053 EGF-like

IPR002049 1509 1548 PF00053 EGF-like

IPR002049 1552 1578 PF00053 EGF-like

HMMSmart IPR001881 194 234 SM00179 EGF-like calcium-binding

IPR006210 202 234 SM00181 EGF

IPR001881 236 276 SM00179 EGF-like calcium-binding

IPR006210 239 276 SM00181 EGF

IPR001881 277 318 SM00179 EGF-like calcium-binding

IPR006210 280 318 SM00181 EGF

IPR006210 322 359 SM00181 EGF

IPR001881 323 359 SM00179 EGF-like calcium-binding

IPR001881 360 400 SM00179 EGF-like calcium-binding

IPR006210 363 400 SM00181 EGF

IPR001881 407 446 SM00179 EGF-like calcium-binding

IPR006210 409 446 SM00181 EGF

IPR001881 447 484 SM00179 EGF-like calcium-binding

IPR006210 450 486 SM00181 EGF

IPR001881 487 527 SM00179 EGF-like calcium-binding

IPR006210 490 527 SM00181 EGF

IPR006210 594 627 SM00181 EGF

IPR006210 638 670 SM00181 EGF

IPR002049 643 682 SM00180 EGF-like

IPR006210 681 713 SM00181 EGF

IPR002049 686 725 SM00180 EGF-like

IPR006210 715 758 SM00181 EGF

IPR002049 729 770 SM00180 EGF-like

IPR006210 760 803 SM00181 EGF

IPR002049 774 815 SM00180 EGF-like

IPR006210 814 845 SM00181 EGF

IPR002049 819 857 SM00180 EGF-like

IPR006210 856 889 SM00181 EGF

IPR002049 861 901 SM00180 EGF-like

IPR006210 900 932 SM00181 EGF

IPR002049 905 944 SM00180 EGF-like

IPR006210 943 976 SM00181 EGF

IPR002049 948 988 SM00180 EGF-like

IPR006210 987 1019 SM00181 EGF

IPR002049 992 1031 SM00180 EGF-like

IPR006210 1030 1062 SM00181 EGF

IPR002049 1035 1074 SM00180 EGF-like

IPR006210 1073 1105 SM00181 EGF

IPR002049 1078 1117 SM00180 EGF-like

IPR006210 1116 1148 SM00181 EGF

IPR002049 1121 1160 SM00180 EGF-like

IPR006210 1150 1191 SM00181 EGF

IPR002049 1165 1203 SM00180 EGF-like

IPR006210 1202 1234 SM00181 EGF

IPR002049 1207 1246 SM00180 EGF-like

IPR006210 1245 1278 SM00181 EGF

IPR002049 1250 1290 SM00180 EGF-like

IPR006210 1289 1321 SM00181 EGF

IPR002049 1294 1333 SM00180 EGF-like

IPR006210 1332 1364 SM00181 EGF

IPR002049 1337 1376 SM00180 EGF-like

IPR006210 1375 1407 SM00181 EGF

IPR002049 1380 1419 SM00180 EGF-like

IPR006210 1418 1450 SM00181 EGF

IPR002049 1423 1462 SM00180 EGF-like

IPR006210 1452 1493 SM00181 EGF

IPR002049 1466 1505 SM00180 EGF-like

IPR006210 1504 1536 SM00181 EGF

IPR002049 1509 1548 SM00180 EGF-like

IPR006210 1547 1579 SM00181 EGF

IPR002049 1552 1599 SM00180 EGF-like

ProfileScan IPR011489 119 200 PS51041 EMI

IPR000742 199 234 PS50026 EGF-like

IPR000742 236 276 PS50026 EGF-like

IPR000742 313 359 PS50026 EGF-like

IPR000742 360 400 PS50026 EGF-like

IPR000742 487 527 PS50026 EGF-like

IPR000742 591 627 PS50026 EGF-like

IPR000742 635 670 PS50026 EGF-like

IPR000742 678 713 PS50026 EGF-like

IPR000742 811 845 PS50026 EGF-like

IPR000742 858 889 PS50026 EGF-like

IPR000742 897 932 PS50026 EGF-like

IPR000742 940 976 PS50026 EGF-like

IPR000742 984 1019 PS50026 EGF-like

IPR000742 1070 1105 PS50026 EGF-like

IPR000742 1113 1148 PS50026 EGF-like

IPR000742 1156 1191 PS50026 EGF-like

IPR000742 1199 1234 PS50026 EGF-like

IPR000742 1286 1321 PS50026 EGF-like

IPR000742 1329 1364 PS50026 EGF-like

IPR000742 1372 1407 PS50026 EGF-like

IPR000742 1420 1450 PS50026 EGF-like

IPR000742 1458 1493 PS50026 EGF-like

IPR000742 1544 1579 PS50026 EGF-like

ScanRegExp IPR013032 222 233 PS00022 EGF-like region

IPR013032 222 233 PS01186 EGF-like region

IPR001881 236 260 PS01187 EGF-like calcium-binding

IPR000152 251 262 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 260 275 PS01186 EGF-like region

IPR013032 302 317 PS01186 EGF-like region

IPR013032 343 358 PS01186 EGF-like region

IPR001881 360 384 PS01187 EGF-like calcium-binding

IPR000152 375 386 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 384 399 PS01186 EGF-like region

IPR013032 430 445 PS01186 EGF-like region

IPR001881 447 470 PS01187 EGF-like calcium-binding

IPR000152 461 472 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 470 485 PS01186 EGF-like region

IPR001881 487 511 PS01187 EGF-like calcium-binding

IPR000152 502 513 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 511 526 PS01186 EGF-like region

IPR013032 615 626 PS00022 EGF-like region

IPR013032 615 630 PS01186 EGF-like region

IPR013032 658 669 PS00022 EGF-like region

IPR013032 701 712 PS00022 EGF-like region

IPR013032 746 757 PS00022 EGF-like region

IPR013032 746 761 PS01186 EGF-like region

IPR013032 833 844 PS00022 EGF-like region

IPR013032 877 888 PS00022 EGF-like region

IPR013032 877 892 PS01186 EGF-like region

IPR013032 920 931 PS00022 EGF-like region

IPR013032 920 935 PS01186 EGF-like region

IPR013032 964 975 PS00022 EGF-like region

IPR013032 964 979 PS01186 EGF-like region

IPR013032 1007 1018 PS00022 EGF-like region

IPR013032 1007 1022 PS01186 EGF-like region

IPR013032 1050 1061 PS00022 EGF-like region

IPR013032 1093 1104 PS00022 EGF-like region

IPR013032 1093 1108 PS01186 EGF-like region

IPR013032 1136 1147 PS00022 EGF-like region

IPR013032 1136 1151 PS01186 EGF-like region

IPR013032 1179 1190 PS00022 EGF-like region

IPR013032 1179 1194 PS01186 EGF-like region

IPR013032 1222 1233 PS00022 EGF-like region

IPR013032 1222 1237 PS01186 EGF-like region

IPR013032 1266 1277 PS00022 EGF-like region

IPR013032 1266 1281 PS01186 EGF-like region

IPR013032 1309 1320 PS00022 EGF-like region

IPR013032 1309 1324 PS01186 EGF-like region

IPR013032 1352 1363 PS00022 EGF-like region

IPR013032 1395 1406 PS00022 EGF-like region

IPR013032 1395 1410 PS01186 EGF-like region

IPR013032 1438 1449 PS00022 EGF-like region

IPR013032 1438 1453 PS01186 EGF-like region

IPR013032 1481 1492 PS00022 EGF-like region

IPR013032 1481 1496 PS01186 EGF-like region

IPR013032 1524 1535 PS00022 EGF-like region

IPR013032 1567 1578 PS00022 EGF-like region

IPR013032 1567 1578 PS01186 EGF-like region

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002049	651	669	PR00011	EGF-like
IPR002049	739	757	PR00011	EGF-like
IPR002049	870	888	PR00011	EGF-like
HMMPfam	IPR011489	133	193	PF07546	EMI
IPR006209	203	233	PF00008	EGF-like
IPR013091	236	275	PF07645	EGF calcium-binding
IPR006209	281	317	PF00008	EGF-like
IPR006209	323	358	PF00008	EGF-like
IPR013091	360	399	PF07645	EGF calcium-binding
IPR006209	410	445	PF00008	EGF-like
IPR013091	487	526	PF07645	EGF calcium-binding
IPR013111	643	669	PF07974	EGF
IPR013111	686	712	PF07974	EGF
IPR002049	866	907	PF00053	EGF-like
IPR002049	948	988	PF00053	EGF-like
IPR002049	992	1035	PF00053	EGF-like
IPR013111	1078	1104	PF07974	EGF
IPR013111	1121	1147	PF07974	EGF
IPR006209	1160	1190	PF00008	EGF-like
IPR002049	1207	1246	PF00053	EGF-like
IPR002049	1250	1290	PF00053	EGF-like
IPR013111	1294	1320	PF07974	EGF
IPR002049	1337	1365	PF00053	EGF-like
IPR002049	1423	1462	PF00053	EGF-like
IPR002049	1509	1548	PF00053	EGF-like
IPR002049	1552	1578	PF00053	EGF-like
HMMSmart	IPR001881	194	234	SM00179	EGF-like calcium-binding
IPR006210	202	234	SM00181	EGF
IPR001881	236	276	SM00179	EGF-like calcium-binding
IPR006210	239	276	SM00181	EGF
IPR001881	277	318	SM00179	EGF-like calcium-binding
IPR006210	280	318	SM00181	EGF
IPR006210	322	359	SM00181	EGF
IPR001881	323	359	SM00179	EGF-like calcium-binding
IPR001881	360	400	SM00179	EGF-like calcium-binding
IPR006210	363	400	SM00181	EGF
IPR001881	407	446	SM00179	EGF-like calcium-binding
IPR006210	409	446	SM00181	EGF
IPR001881	447	484	SM00179	EGF-like calcium-binding
IPR006210	450	486	SM00181	EGF
IPR001881	487	527	SM00179	EGF-like calcium-binding
IPR006210	490	527	SM00181	EGF
IPR006210	594	627	SM00181	EGF
IPR006210	638	670	SM00181	EGF
IPR002049	643	682	SM00180	EGF-like
IPR006210	681	713	SM00181	EGF
IPR002049	686	725	SM00180	EGF-like
IPR006210	715	758	SM00181	EGF
IPR002049	729	770	SM00180	EGF-like
IPR006210	760	803	SM00181	EGF
IPR002049	774	815	SM00180	EGF-like
IPR006210	814	845	SM00181	EGF
IPR002049	819	857	SM00180	EGF-like
IPR006210	856	889	SM00181	EGF
IPR002049	861	901	SM00180	EGF-like
IPR006210	900	932	SM00181	EGF
IPR002049	905	944	SM00180	EGF-like
IPR006210	943	976	SM00181	EGF
IPR002049	948	988	SM00180	EGF-like
IPR006210	987	1019	SM00181	EGF
IPR002049	992	1031	SM00180	EGF-like
IPR006210	1030	1062	SM00181	EGF
IPR002049	1035	1074	SM00180	EGF-like
IPR006210	1073	1105	SM00181	EGF
IPR002049	1078	1117	SM00180	EGF-like
IPR006210	1116	1148	SM00181	EGF
IPR002049	1121	1160	SM00180	EGF-like
IPR006210	1150	1191	SM00181	EGF
IPR002049	1165	1203	SM00180	EGF-like
IPR006210	1202	1234	SM00181	EGF
IPR002049	1207	1246	SM00180	EGF-like
IPR006210	1245	1278	SM00181	EGF
IPR002049	1250	1290	SM00180	EGF-like
IPR006210	1289	1321	SM00181	EGF
IPR002049	1294	1333	SM00180	EGF-like
IPR006210	1332	1364	SM00181	EGF
IPR002049	1337	1376	SM00180	EGF-like
IPR006210	1375	1407	SM00181	EGF
IPR002049	1380	1419	SM00180	EGF-like
IPR006210	1418	1450	SM00181	EGF
IPR002049	1423	1462	SM00180	EGF-like
IPR006210	1452	1493	SM00181	EGF
IPR002049	1466	1505	SM00180	EGF-like
IPR006210	1504	1536	SM00181	EGF
IPR002049	1509	1548	SM00180	EGF-like
IPR006210	1547	1579	SM00181	EGF
IPR002049	1552	1599	SM00180	EGF-like
ProfileScan	IPR011489	119	200	PS51041	EMI
IPR000742	199	234	PS50026	EGF-like
IPR000742	236	276	PS50026	EGF-like
IPR000742	313	359	PS50026	EGF-like
IPR000742	360	400	PS50026	EGF-like
IPR000742	487	527	PS50026	EGF-like
IPR000742	591	627	PS50026	EGF-like
IPR000742	635	670	PS50026	EGF-like
IPR000742	678	713	PS50026	EGF-like
IPR000742	811	845	PS50026	EGF-like
IPR000742	858	889	PS50026	EGF-like
IPR000742	897	932	PS50026	EGF-like
IPR000742	940	976	PS50026	EGF-like
IPR000742	984	1019	PS50026	EGF-like
IPR000742	1070	1105	PS50026	EGF-like
IPR000742	1113	1148	PS50026	EGF-like
IPR000742	1156	1191	PS50026	EGF-like
IPR000742	1199	1234	PS50026	EGF-like
IPR000742	1286	1321	PS50026	EGF-like
IPR000742	1329	1364	PS50026	EGF-like
IPR000742	1372	1407	PS50026	EGF-like
IPR000742	1420	1450	PS50026	EGF-like
IPR000742	1458	1493	PS50026	EGF-like
IPR000742	1544	1579	PS50026	EGF-like
ScanRegExp	IPR013032	222	233	PS00022	EGF-like region
IPR013032	222	233	PS01186	EGF-like region
IPR001881	236	260	PS01187	EGF-like calcium-binding
IPR000152	251	262	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	260	275	PS01186	EGF-like region
IPR013032	302	317	PS01186	EGF-like region
IPR013032	343	358	PS01186	EGF-like region
IPR001881	360	384	PS01187	EGF-like calcium-binding
IPR000152	375	386	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	384	399	PS01186	EGF-like region
IPR013032	430	445	PS01186	EGF-like region
IPR001881	447	470	PS01187	EGF-like calcium-binding
IPR000152	461	472	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	470	485	PS01186	EGF-like region
IPR001881	487	511	PS01187	EGF-like calcium-binding
IPR000152	502	513	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	511	526	PS01186	EGF-like region
IPR013032	615	626	PS00022	EGF-like region
IPR013032	615	630	PS01186	EGF-like region
IPR013032	658	669	PS00022	EGF-like region
IPR013032	701	712	PS00022	EGF-like region
IPR013032	746	757	PS00022	EGF-like region
IPR013032	746	761	PS01186	EGF-like region
IPR013032	833	844	PS00022	EGF-like region
IPR013032	877	888	PS00022	EGF-like region
IPR013032	877	892	PS01186	EGF-like region
IPR013032	920	931	PS00022	EGF-like region
IPR013032	920	935	PS01186	EGF-like region
IPR013032	964	975	PS00022	EGF-like region
IPR013032	964	979	PS01186	EGF-like region
IPR013032	1007	1018	PS00022	EGF-like region
IPR013032	1007	1022	PS01186	EGF-like region
IPR013032	1050	1061	PS00022	EGF-like region
IPR013032	1093	1104	PS00022	EGF-like region
IPR013032	1093	1108	PS01186	EGF-like region
IPR013032	1136	1147	PS00022	EGF-like region
IPR013032	1136	1151	PS01186	EGF-like region
IPR013032	1179	1190	PS00022	EGF-like region
IPR013032	1179	1194	PS01186	EGF-like region
IPR013032	1222	1233	PS00022	EGF-like region
IPR013032	1222	1237	PS01186	EGF-like region
IPR013032	1266	1277	PS00022	EGF-like region
IPR013032	1266	1281	PS01186	EGF-like region
IPR013032	1309	1320	PS00022	EGF-like region
IPR013032	1309	1324	PS01186	EGF-like region
IPR013032	1352	1363	PS00022	EGF-like region
IPR013032	1395	1406	PS00022	EGF-like region
IPR013032	1395	1410	PS01186	EGF-like region
IPR013032	1438	1449	PS00022	EGF-like region
IPR013032	1438	1453	PS01186	EGF-like region
IPR013032	1481	1492	PS00022	EGF-like region
IPR013032	1481	1496	PS01186	EGF-like region
IPR013032	1524	1535	PS00022	EGF-like region
IPR013032	1567	1578	PS00022	EGF-like region
IPR013032	1567	1578	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 84 AAGRAVVLALVLLLLPAVPVGAS 106 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	84	AAGRAVVLALVLLLLPAVPVGAS	106	PRIMARY	23

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTCGCCCAGCCCGTATTTATG
Primer_r	: GATTGGGCAGGAGATGACAGG
PCR product length	: 102 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	531 bp
Genome contig ID	gi89161185r_3296350
PolyA signal sequence (None)	+--------+--------+----*----+---- GTACCATGTAAACCTAGGAAGGTAAAGGAGCAGGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCTCCTCGTGGCCTGTGTGTTTGCTGTGTTACGTGGACTCTGTGTGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	3396350	3517919	37	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0815

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information