HUGE |
Gene/Protein Characteristic Table for KIAA0712 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00610 |
---|---|
Accession No. : | AB018255 |
Description : | Rho GTPase-activating protein. |
HUGO Gene Name : | |
Clone Name : | hg04169 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0712
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6477 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 960 bp Genome contig ID gi51511727r_128243052 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CATTGGTTTTCCTAAATTATCAACTTTCTTTCATTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAGCCCAGCATGGTTTGACTGGATAGACAC
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 r 128343052 128399219 13 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1770 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000198 | 69 | 222 | PF00620 | RhoGAP |
HMMSmart | IPR000198 | 66 | 247 | SM00324 | RhoGAP |
ProfileScan | IPR000198 | 55 | 250 | PS50238 | RhoGAP |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TGTGTTCAGTTAGAGTCGTGG | |
: CTGAGTCTAAGTGGTCTGGTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 11 |
: GeneBridge 4 | |
: TGTGTTCAGTTAGAGTCGTGG | |
: CTGAGTCTAAGTGGTCTGGTG | |
: 146 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |