HUGE

Gene/Protein Characteristic Table for KIAA1204

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00200
Accession No. :	AB033030
Description :	Cdc42 GTPase-activating protein.
HUGO Gene Name :
Clone Name :	fg03451 [Vector Info]
Flexi ORF Clone :	pF1KA1204
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 6321 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1454 bp

Genome contig ID gi89161205f_120395919
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
AAGCAGAAGCAATAAACCAATCTGATTTTCTTTTC
Flanking genome sequence
(223337 - 223386)
----+----*----+----*----+----*----+----*----+----*
AATTATTTATAACTTTCAATGGTTCTTTCCTTTCCAGCTGGCGAGAGAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 120495910 120619254 12 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 1445 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q2M1Z3	100.0	Cdc42 GTPase-ac...	Homo sapiens
EAW79573	99.9	Cdc42 GTPase-ac...	Homo sapiens
XP_001162142	98.8	Cdc42 GTPase-ac...	Pan troglodytes
XP_593520	83.7	similar to Cdc4...	Bos taurus
XP_856487	82.7	similar to Cdc4...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018255	5.4e-24	28.8	KIAA0712
AB040934	7.2e-05	31.1	KIAA1501
AB014572	0.00021	24.7	KIAA0672
AB037845	0.00044	21.6	KIAA1424
AB014521	0.00086	26.9	KIAA0621

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000198 36 188 PF00620 RhoGAP

HMMSmart IPR000198 33 214 SM00324 RhoGAP

ProfileScan IPR000198 22 217 PS50238 RhoGAP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000198	36	188	PF00620	RhoGAP
HMMSmart	IPR000198	33	214	SM00324	RhoGAP
ProfileScan	IPR000198	22	217	PS50238	RhoGAP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CATACAAAGGCAGAACTACAC

Primer_r
: CAGTGAGTGGTTGTGATGGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1454 bp
Genome contig ID	gi89161205f_120395919
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AAGCAGAAGCAATAAACCAATCTGATTTTCTTTTC
Flanking genome sequence (223337 - 223386)	----+--------+--------+--------+--------+----* AATTATTTATAACTTTCAATGGTTCTTTCCTTTCCAGCTGGCGAGAGAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	120495910	120619254	12	99.3	Perfect prediction

Primer_f	: CATACAAAGGCAGAACTACAC
Primer_r	: CAGTGAGTGGTTGTGATGGCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1204

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information