ROUGE

Gene/Protein Characteristic Table for mKIAA0712

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173008
Description :	Rho GTPase-activating protein. GAB-associated CDC42. rac GTPase activating protein. RhoGAP involved in the beta -catenin-N-cadherin and NMDA receptor signaling.
Clone Name :	mfj21130 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4671 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3149 bp

Genome contig ID gi65519420f_32080815
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GGTTTTTGATTTCGTGTTGCTAAAAAAAAAAAAAG
Flanking genome sequence
(108368 - 108417)
----+----*----+----*----+----*----+----*----+----*
CTTTCCAGTGAAACCTTTATTTCCTTATTGATCATGCGACTCTTGAACAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0712 DNA sequence, AA sequence

KIAA	Alignment based on:
KIAA0712	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 2..1522
Length: 506 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL25353	1.4e-205	100.0	mCG14024 [Mus m...	Mus musculus
AAO43676	2.1e-205	100.0	rac GTPase acti...	Mus musculus
Q811P8	2.4e-205	100.0	Rho/Cdc42/Rac G...	Mus musculus
EDL83300	1.5e-195	94.7	rCG22711 [Rattu...	Rattus norvegicus
AAI68683	1.9e-195	94.7	Rics protein [R...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3149 bp
Genome contig ID	gi65519420f_32080815
PolyA signal sequence (None)	+--------+--------+----*----+---- GGTTTTTGATTTCGTGTTGCTAAAAAAAAAAAAAG
Flanking genome sequence (108368 - 108417)	----+--------+--------+--------+--------+----* CTTTCCAGTGAAACCTTTATTTCCTTATTGATCATGCGACTCTTGAACAG

Gene/Protein Characteristic Table for mKIAA0712

Features of the cloned DNA sequence

Features of the protein sequence