HUGE

Gene/Protein Characteristic Table for KIAA0580

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04531
Accession No. :	AB011152
Description :	Centaurin-delta 1.
HUGO Gene Name :
Clone Name :	hj00601s1 [Vector Info]
Flexi ORF Clone :	pF1KA0580
Source :	Human adult brain
Note :	We replaced hj00601, former representative clones for KIAA0580 with hj00601s1. (2003/4/2)

Features of the cloned DNA sequence	Description

Length: 6802 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1906 bp

Genome contig ID gi89161207r_35644017
PolyA signal sequence
(ATTAAA,-27)
+----*----+----*----+----*----+----
GAGTAAACATTAAAATTGTTTTACAAGTCTACTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATGTGACTTTATTATTTTCAGAAGTTGAAGGTTGTTATTGTGAAATAGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 r 35744017 35907284 32 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1631 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI50259	100.0	CENTD1 protein ...	Homo sapiens
Q8WZ64	100.0	Arf-GAP, Rho-GA...	Homo sapiens
EAW92872	99.9	centaurin, delt...	Homo sapiens
AAL32459	99.9	PARX protein [H...	Homo sapiens
XP_001135477	99.1	centaurin delta...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018325	3.9e-127	41.7	KIAA0782
D79989	1.8e-11	29.4	KIAA0167
AB075855	5.4e-11	29.6	KIAA1975
AB029022	9.5e-11	28.4	KIAA1099
D26069	2e-08	31.4	KIAA0041

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001164 624 643 PR00405 Arf GTPase activating protein

IPR001164 643 660 PR00405 Arf GTPase activating protein

HMMPfam IPR001849 410 501 PF00169 Pleckstrin-like

IPR001849 515 606 PF00169 Pleckstrin-like

IPR001164 612 734 PF01412 Arf GTPase activating protein

IPR001849 820 930 PF00169 Pleckstrin-like

IPR000198 1056 1209 PF00620 RhoGAP

IPR000159 1253 1347 PF00788 Ras-association

IPR001849 1362 1464 PF00169 Pleckstrin-like

HMMSmart IPR001849 410 503 SM00233 Pleckstrin-like

IPR001849 515 608 SM00233 Pleckstrin-like

IPR001164 613 734 SM00105 Arf GTPase activating protein

IPR001849 820 932 SM00233 Pleckstrin-like

IPR001849 942 1041 SM00233 Pleckstrin-like

IPR000198 1053 1229 SM00324 RhoGAP

IPR001849 1362 1466 SM00233 Pleckstrin-like

ProfileScan IPR001849 409 501 PS50003 Pleckstrin-like

IPR001849 514 606 PS50003 Pleckstrin-like

IPR001164 603 738 PS50115 Arf GTPase activating protein

IPR001849 805 930 PS50003 Pleckstrin-like

IPR000198 1043 1224 PS50238 RhoGAP

IPR000159 1253 1347 PS50200 Ras-association

IPR001849 1361 1464 PS50003 Pleckstrin-like

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001164	624	643	PR00405	Arf GTPase activating protein
IPR001164	643	660	PR00405	Arf GTPase activating protein
HMMPfam	IPR001849	410	501	PF00169	Pleckstrin-like
IPR001849	515	606	PF00169	Pleckstrin-like
IPR001164	612	734	PF01412	Arf GTPase activating protein
IPR001849	820	930	PF00169	Pleckstrin-like
IPR000198	1056	1209	PF00620	RhoGAP
IPR000159	1253	1347	PF00788	Ras-association
IPR001849	1362	1464	PF00169	Pleckstrin-like
HMMSmart	IPR001849	410	503	SM00233	Pleckstrin-like
IPR001849	515	608	SM00233	Pleckstrin-like
IPR001164	613	734	SM00105	Arf GTPase activating protein
IPR001849	820	932	SM00233	Pleckstrin-like
IPR001849	942	1041	SM00233	Pleckstrin-like
IPR000198	1053	1229	SM00324	RhoGAP
IPR001849	1362	1466	SM00233	Pleckstrin-like
ProfileScan	IPR001849	409	501	PS50003	Pleckstrin-like
IPR001849	514	606	PS50003	Pleckstrin-like
IPR001164	603	738	PS50115	Arf GTPase activating protein
IPR001849	805	930	PS50003	Pleckstrin-like
IPR000198	1043	1224	PS50238	RhoGAP
IPR000159	1253	1347	PS50200	Ras-association
IPR001849	1361	1464	PS50003	Pleckstrin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GGACAGTGGAAAAGTATCTAG

Primer_r
: GTCATCATTAGCCCTTATCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGACAGTGGAAAAGTATCTAG
Primer_r	: GTCATCATTAGCCCTTATCTC
PCR product length	: 146 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1906 bp
Genome contig ID	gi89161207r_35644017
PolyA signal sequence (ATTAAA,-27)	+--------+--------+----*----+---- GAGTAAACATTAAAATTGTTTTACAAGTCTACTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGTGACTTTATTATTTTCAGAAGTTGAAGGTTGTTATTGTGAAATAGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	r	35744017	35907284	32	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0580

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information