Gene/Protein Characteristic Table for mKIAA0580

Length: 4654 bp

Restriction map

Length of 3'UTR	1816 bp
Genome contig ID	gi65498774r_61309121
PolyA signal sequence (ATTAAA,-26)	+----*----+----*----+----*----+---- TGAGTAACAATTAAAATAGTTTTACAAGTCCAGTG
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* AAATATGCCTCTTGTGTCTCTTTATTACTTTCAGAAATTTAAATTCATTA

KIAA	Alignment based on:
KIAA0580	DNA sequence, AA sequence, Physical map

Coding region: 1..2838

Length: 945 aa

Entry Exp ID% Protein Source Q8BZ05 0 100.0 Arf-GAP, Rho-GA... Mus musculus NP_848494 0 99.9 ArfGAP with Rho... Mus musculus AAI50259 0 88.7 ARAP2 protein [... Homo sapiens Q8WZ64 0 88.7 Arf-GAP, Rho-GA... Homo sapiens AAL32459 0 88.7 PARX protein [H... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK129213 1.9e-99 39.8 mKIAA0782 AK220486 5e-85 36.9 mKIAA4097 AK173187 2e-10 29.7 mKIAA1501 AK129482 5.3e-09 27.4 mKIAA3017 AK122508 1.3e-08 27.8 mKIAA1424

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	133	243	PF00169	Pleckstrin-like
	IPR000198	369	522	PF00620	RhoGAP
	IPR000159	566	660	PF00788	RA
	IPR001849	671	773	PF00169	Pleckstrin-like
HMMSmart	IPR001849	133	245	SM00233	Pleckstrin-like
	IPR001849	255	354	SM00233	Pleckstrin-like
	IPR000198	366	542	SM00324	RhoGAP
	IPR001849	671	775	SM00233	Pleckstrin-like
ProfileScan	IPR001849	160	243	PS50003	Pleckstrin-like
	IPR000198	369	514	PS50238	RhoGAP
	IPR001849	670	773	PS50003	Pleckstrin-like

Method	From	To	amino acid sequence
-	-	-	-