HUGE

Gene/Protein Characteristic Table for KIAA0041

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00006
Accession No. :	D26069
Description :	Centaurin-beta 2.
HUGO Gene Name :	ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 (ACAP2)
Clone Name :	ha00469s1 [Vector Info]
Flexi ORF Clone :	pF1KA0041
Source :	Myeloblast cell line (KG-1)
Note :	We replaced ha00469, former representative clones for KIAA0041 with ha00469s1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 6926 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4579 bp

Genome contig ID gi89161205r_196376764
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TTACAATAAGTCAATAAAGATCTCACCTCTGGCTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTTCTTTCATGGTGATTTACATTTTCTTGTGAAATACACTGTGAACATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 196476764 196644875 23 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 781 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_516962	100.0	centaurin, beta...	Pan troglodytes
XP_001093762	99.5	centaurin, beta...	Macaca mulatta
Q15057	100.0	ARFGAP with coi...	Homo sapiens
AAH60767	99.9	Centaurin, beta...	Homo sapiens
Q6IVG4	98.1	ARFGAP with coi...	Oryctolagus cun...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051503	1.9e-103	61.0	KIAA1716
D30758	2.8e-80	51.5	KIAA0050
AB007860	3.2e-18	28.4	KIAA0400
AB033075	6.3e-15	30.1	KIAA1249
AB075855	3.2e-14	31.6	KIAA1975

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001164 414 433 PR00405 Arf GTPase activating protein

IPR001164 433 450 PR00405 Arf GTPase activating protein

IPR001164 454 475 PR00405 Arf GTPase activating protein

IPR002110 677 689 PR01415 Ankyrin

IPR002110 689 701 PR01415 Ankyrin

HMMPfam IPR001849 270 364 PF00169 Pleckstrin-like

IPR001164 402 523 PF01412 Arf GTPase activating protein

IPR002110 629 640 PF00023 Ankyrin

IPR002110 643 675 PF00023 Ankyrin

IPR002110 676 708 PF00023 Ankyrin

IPR002110 709 729 PF00023 Ankyrin

HMMSmart IPR001849 270 366 SM00233 Pleckstrin-like

IPR001164 402 523 SM00105 Arf GTPase activating protein

IPR002110 643 672 SM00248 Ankyrin

IPR002110 676 705 SM00248 Ankyrin

IPR002110 709 738 SM00248 Ankyrin

ProfileScan IPR001849 269 364 PS50003 Pleckstrin-like

IPR001164 402 523 PS50115 Arf GTPase activating protein

IPR002110 608 741 PS50297 Ankyrin

IPR002110 643 675 PS50088 Ankyrin

IPR002110 676 708 PS50088 Ankyrin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001164	414	433	PR00405	Arf GTPase activating protein
IPR001164	433	450	PR00405	Arf GTPase activating protein
IPR001164	454	475	PR00405	Arf GTPase activating protein
IPR002110	677	689	PR01415	Ankyrin
IPR002110	689	701	PR01415	Ankyrin
HMMPfam	IPR001849	270	364	PF00169	Pleckstrin-like
IPR001164	402	523	PF01412	Arf GTPase activating protein
IPR002110	629	640	PF00023	Ankyrin
IPR002110	643	675	PF00023	Ankyrin
IPR002110	676	708	PF00023	Ankyrin
IPR002110	709	729	PF00023	Ankyrin
HMMSmart	IPR001849	270	366	SM00233	Pleckstrin-like
IPR001164	402	523	SM00105	Arf GTPase activating protein
IPR002110	643	672	SM00248	Ankyrin
IPR002110	676	705	SM00248	Ankyrin
IPR002110	709	738	SM00248	Ankyrin
ProfileScan	IPR001849	269	364	PS50003	Pleckstrin-like
IPR001164	402	523	PS50115	Arf GTPase activating protein
IPR002110	608	741	PS50297	Ankyrin
IPR002110	643	675	PS50088	Ankyrin
IPR002110	676	708	PS50088	Ankyrin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: Stanford G3
Primer_f	: GTTCATAAATGCGGTCGG
Primer_r	: GGGGAATCAACCCAACAA
PCR product length	: 206 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4579 bp
Genome contig ID	gi89161205r_196376764
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTACAATAAGTCAATAAAGATCTCACCTCTGGCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTTCTTTCATGGTGATTTACATTTTCTTGTGAAATACACTGTGAACATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	196476764	196644875	23	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0041

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information