| HUGE |
Gene/Protein Characteristic Table for KIAA0865 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK01612 |
|---|---|
| Accession No. : | AB020672 |
| Description : | Myosin-XVI. |
| HUGO Gene Name : | myosin XVI (MYO16) |
| Clone Name : | hk06640y1 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0865
|
| Source : | Human adult brain |
| Note : | We replaced hk06640, former representative clones for KIAA0865 with hk06640y1. (2003/4/2) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6864 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1161 bp Genome contig ID gi51511729f_107946501 PolyA signal sequence
(AATAAA,-20)
AAAAGTTACTGTGCCAATAAAGAGGTACAACTGTGFlanking genome sequence
(711847 - 711896)
TTCTTCTATTGTTTTTGTTGTTGTTATTATTGTCTCCCATGAACTCTTGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 13 f 108046501 108658346 35 99.6 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1900 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
|---|---|---|
| : 13 |
| : GeneBridge 4 | |
| : CCTCGCTGTATATCCTCAACC | |
| : TCCAAGTAGCAAGACAAGGTG | |
| : 117 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
