ROUGE |
Gene/Protein Characteristic Table for mKIAA0389 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK172941 |
---|---|
mbg10987 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5519 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3858 bp Genome contig ID gi65519420f_80389102 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
CTGGAAATTCAAATAAATTGCCTTATGTGTAGAACFlanking genome sequence
(130049 - 130098) ----+----*----+----*----+----*----+----*----+----*
ATCCTTGTGTATTGTGTGCTTTTAATCCAGGGTGCAAGTTGTCACACTGT
KIAA Alignment based on: KIAA0389 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..1661
Length: 552 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |