| HUGE |
Gene/Protein Characteristic Table for KIAA0283 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK00494 |
|---|---|
| Accession No. : | AB006621 |
| Description : | Receptor-type tyrosine-protein phosphatase T precursor. |
| HUGO Gene Name : | protein tyrosine phosphatase, receptor type, T (PTPRT) |
| Clone Name : | ha06139s1 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0283
![]() |
| Source : | Human adult brain |
| Note : | We replaced ha06139, former representative clones for KIAA0283 with ha06139s1. (2002/12/27) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 12523 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 8105 bp Genome contig ID gi51511747r_40034828 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
TGTTAAAAAATCTATACAATAAAGCTGTGACCCTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGATTCATGTTTTCCTAAGATATTCGTACTGGTGTCTTCCTGAGGTTGGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 20 r 40134828 41251879 30 99.3 Internal No-hit
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1471 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
|---|---|---|
| : 20 |
| : Genebridge 4 | |
| : GCTATCCCAAGGTTCCCGCTC | |
| : GGCTGCAAAGAGTGTGGAGAC | |
| : 102 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |