HUGE |
Gene/Protein Characteristic Table for KIAA1496 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04595 |
---|---|
Accession No. : | AB040929 |
Description : | Contactin-3 precursor. |
HUGO Gene Name : | |
Clone Name : | fj09513 [Vector Info] |
Flexi ORF Clone : | pF1KA1496
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4594 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1830 bp Genome contig ID gi89161205r_74294412 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TATTATTTTCTATTCTAATAAAATTTATAACAAGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAATGAGTGTGCAGTATTAATTGCGGTATGGTCAAAGAAGAATGTCTACA
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 r 74394412 74556781 19 99.9 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 920 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013151 | 29 | 90 | PF00047 | Immunoglobulin |
IPR013098 | 119 | 206 | PF07679 | Immunoglobulin I-set | |
IPR013098 | 210 | 295 | PF07679 | Immunoglobulin I-set | |
IPR013098 | 300 | 388 | PF07679 | Immunoglobulin I-set | |
IPR013151 | 406 | 471 | PF00047 | Immunoglobulin | |
IPR003961 | 490 | 579 | PF00041 | Fibronectin | |
IPR003961 | 592 | 682 | PF00041 | Fibronectin | |
IPR003961 | 694 | 783 | PF00041 | Fibronectin | |
IPR003961 | 795 | 878 | PF00041 | Fibronectin | |
HMMSmart | IPR003599 | 21 | 109 | SM00409 | Immunoglobulin subtype |
IPR003598 | 27 | 95 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 126 | 207 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 132 | 196 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 216 | 296 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 222 | 285 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 308 | 389 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 314 | 378 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 398 | 487 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 404 | 476 | SM00408 | Immunoglobulin subtype 2 | |
IPR003961 | 490 | 576 | SM00060 | Fibronectin | |
IPR003961 | 593 | 679 | SM00060 | Fibronectin | |
IPR003961 | 695 | 780 | SM00060 | Fibronectin | |
IPR003961 | 795 | 875 | SM00060 | Fibronectin | |
ProfileScan | IPR007110 | 14 | 100 | PS50835 | Immunoglobulin-like |
IPR007110 | 119 | 205 | PS50835 | Immunoglobulin-like | |
IPR007110 | 210 | 294 | PS50835 | Immunoglobulin-like | |
IPR007110 | 300 | 389 | PS50835 | Immunoglobulin-like | |
IPR007110 | 391 | 485 | PS50835 | Immunoglobulin-like | |
IPR003961 | 490 | 585 | PS50853 | Fibronectin | |
IPR003961 | 592 | 690 | PS50853 | Fibronectin | |
IPR003961 | 694 | 790 | PS50853 | Fibronectin | |
IPR003961 | 795 | 884 | PS50853 | Fibronectin |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GGAATGCCACAGACACTAAAG | |
: GTCCTCTTTAATGGGCAGCAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 3 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |