HUGE

Gene/Protein Characteristic Table for KIAA1496

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04595
Accession No. :	AB040929
Description :	Contactin-3 precursor.
HUGO Gene Name :
Clone Name :	fj09513 [Vector Info]
Flexi ORF Clone :	pF1KA1496
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4594 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1830 bp

Genome contig ID gi89161205r_74294412
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TATTATTTTCTATTCTAATAAAATTTATAACAAGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATGAGTGTGCAGTATTAATTGCGGTATGGTCAAAGAAGAATGTCTACA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 74394412 74556781 19 99.9 Terminal No-hit

Features of the protein sequence	Description

Length: 920 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10467	100.0	contactin-3 pre...	synthetic construct
Q9P232	100.0	Contactin-3; Br...	Homo sapiens
XP_526232	99.8	contactin 3 iso...	Pan troglodytes
XP_001143126	99.6	contactin 3 iso...	Pan troglodytes
XP_001143207	99.5	contactin 3 iso...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002341	5.6e-61	29.5	KIAA0343
AB018299	3.5e-35	28.3	KIAA0756
AB032958	9.9e-32	24.9	KIAA1132
AB046788	2e-23	27.5	KIAA1568
AB040947	3.8e-13	30.8	KIAA1514

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013151 29 90 PF00047 Immunoglobulin

IPR013098 119 206 PF07679 Immunoglobulin I-set

IPR013098 210 295 PF07679 Immunoglobulin I-set

IPR013098 300 388 PF07679 Immunoglobulin I-set

IPR013151 406 471 PF00047 Immunoglobulin

IPR003961 490 579 PF00041 Fibronectin

IPR003961 592 682 PF00041 Fibronectin

IPR003961 694 783 PF00041 Fibronectin

IPR003961 795 878 PF00041 Fibronectin

HMMSmart IPR003599 21 109 SM00409 Immunoglobulin subtype

IPR003598 27 95 SM00408 Immunoglobulin subtype 2

IPR003599 126 207 SM00409 Immunoglobulin subtype

IPR003598 132 196 SM00408 Immunoglobulin subtype 2

IPR003599 216 296 SM00409 Immunoglobulin subtype

IPR003598 222 285 SM00408 Immunoglobulin subtype 2

IPR003599 308 389 SM00409 Immunoglobulin subtype

IPR003598 314 378 SM00408 Immunoglobulin subtype 2

IPR003599 398 487 SM00409 Immunoglobulin subtype

IPR003598 404 476 SM00408 Immunoglobulin subtype 2

IPR003961 490 576 SM00060 Fibronectin

IPR003961 593 679 SM00060 Fibronectin

IPR003961 695 780 SM00060 Fibronectin

IPR003961 795 875 SM00060 Fibronectin

ProfileScan IPR007110 14 100 PS50835 Immunoglobulin-like

IPR007110 119 205 PS50835 Immunoglobulin-like

IPR007110 210 294 PS50835 Immunoglobulin-like

IPR007110 300 389 PS50835 Immunoglobulin-like

IPR007110 391 485 PS50835 Immunoglobulin-like

IPR003961 490 585 PS50853 Fibronectin

IPR003961 592 690 PS50853 Fibronectin

IPR003961 694 790 PS50853 Fibronectin

IPR003961 795 884 PS50853 Fibronectin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013151	29	90	PF00047	Immunoglobulin
IPR013098	119	206	PF07679	Immunoglobulin I-set
IPR013098	210	295	PF07679	Immunoglobulin I-set
IPR013098	300	388	PF07679	Immunoglobulin I-set
IPR013151	406	471	PF00047	Immunoglobulin
IPR003961	490	579	PF00041	Fibronectin
IPR003961	592	682	PF00041	Fibronectin
IPR003961	694	783	PF00041	Fibronectin
IPR003961	795	878	PF00041	Fibronectin
HMMSmart	IPR003599	21	109	SM00409	Immunoglobulin subtype
IPR003598	27	95	SM00408	Immunoglobulin subtype 2
IPR003599	126	207	SM00409	Immunoglobulin subtype
IPR003598	132	196	SM00408	Immunoglobulin subtype 2
IPR003599	216	296	SM00409	Immunoglobulin subtype
IPR003598	222	285	SM00408	Immunoglobulin subtype 2
IPR003599	308	389	SM00409	Immunoglobulin subtype
IPR003598	314	378	SM00408	Immunoglobulin subtype 2
IPR003599	398	487	SM00409	Immunoglobulin subtype
IPR003598	404	476	SM00408	Immunoglobulin subtype 2
IPR003961	490	576	SM00060	Fibronectin
IPR003961	593	679	SM00060	Fibronectin
IPR003961	695	780	SM00060	Fibronectin
IPR003961	795	875	SM00060	Fibronectin
ProfileScan	IPR007110	14	100	PS50835	Immunoglobulin-like
IPR007110	119	205	PS50835	Immunoglobulin-like
IPR007110	210	294	PS50835	Immunoglobulin-like
IPR007110	300	389	PS50835	Immunoglobulin-like
IPR007110	391	485	PS50835	Immunoglobulin-like
IPR003961	490	585	PS50853	Fibronectin
IPR003961	592	690	PS50853	Fibronectin
IPR003961	694	790	PS50853	Fibronectin
IPR003961	795	884	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGAATGCCACAGACACTAAAG

Primer_r
: GTCCTCTTTAATGGGCAGCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1830 bp
Genome contig ID	gi89161205r_74294412
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TATTATTTTCTATTCTAATAAAATTTATAACAAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATGAGTGTGCAGTATTAATTGCGGTATGGTCAAAGAAGAATGTCTACA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	74394412	74556781	19	99.9	Terminal No-hit

Primer_f	: GGAATGCCACAGACACTAAAG
Primer_r	: GTCCTCTTTAATGGGCAGCAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1496

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information