HUGE

Gene/Protein Characteristic Table for KIAA1471

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06531
Accession No. :	AB040904
Description :	Tyrosine-protein phosphatase non-receptor type 23.
HUGO Gene Name :	protein tyrosine phosphatase, non-receptor type 23 (PTPN23)
Clone Name :	fj02383s1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fj02383, former representative clones for KIAA1471 with fj02383s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4265 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 0 bp

Genome contig ID gi89161205f_47297476
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GGAGGTGCACGCACATTACCTGCATCAGCGGCCGC
Flanking genome sequence
(131190 - 131239)
----+----*----+----*----+----*----+----*----+----*
TGCACACGCCCATCATTGTGCACTGCAGGTAGAGGGTGGGCCTGAGGGTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 47397476 47428664 22 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1421 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9H3S7	99.9	Tyrosine-protei...	Homo sapiens
EAW64822	99.7	protein tyrosin...	Homo sapiens
XP_001100428	97.1	similar to prot...	Macaca mulatta
XP_001495556	93.2	protein tyrosin...	Equus caballus
BAG61747	99.9	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067516	0.0001	33.2	KIAA1929
AB051547	0.00014	29.2	KIAA1760
AB007927	0.00038	25.7	KIAA0458
AB051468	0.00068	25.9	KIAA1681

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000242 1280 1287 PR00700 Protein-tyrosine phosphatase

IPR000242 1297 1317 PR00700 Protein-tyrosine phosphatase

IPR000242 1383 1400 PR00700 Protein-tyrosine phosphatase

HMMPfam IPR004328 46 422 PF03097 BRO1

IPR000242 1255 1418 PF00102 Protein-tyrosine phosphatase

HMMSmart IPR000242 1228 1421 SM00194 Protein-tyrosine phosphatase

ProfileScan IPR004328 46 432 PS51180 BRO1

IPR000242 1258 1421 PS50055 Protein-tyrosine phosphatase

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000242	1280	1287	PR00700	Protein-tyrosine phosphatase
IPR000242	1297	1317	PR00700	Protein-tyrosine phosphatase
IPR000242	1383	1400	PR00700	Protein-tyrosine phosphatase
HMMPfam	IPR004328	46	422	PF03097	BRO1
IPR000242	1255	1418	PF00102	Protein-tyrosine phosphatase
HMMSmart	IPR000242	1228	1421	SM00194	Protein-tyrosine phosphatase
ProfileScan	IPR004328	46	432	PS51180	BRO1
IPR000242	1258	1421	PS50055	Protein-tyrosine phosphatase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GAGGACATCAAGTACGAGCAG

Primer_r
: CTTCATGCCCTCCTCAGACAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATGACATCACTGCCTCGCTGG
Primer_r	: TACTGCACGTTGGCCTCTGTC
PCR product length	: 160(250) bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	0 bp
Genome contig ID	gi89161205f_47297476
PolyA signal sequence (None)	+--------+--------+----*----+---- GGAGGTGCACGCACATTACCTGCATCAGCGGCCGC
Flanking genome sequence (131190 - 131239)	----+--------+--------+--------+--------+----* TGCACACGCCCATCATTGTGCACTGCAGGTAGAGGGTGGGCCTGAGGGTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	47397476	47428664	22	99.6	Perfect prediction

Primer_f	: GAGGACATCAAGTACGAGCAG
Primer_r	: CTTCATGCCCTCCTCAGACAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1471

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information