| HUGE |
Gene/Protein Characteristic Table for KIAA0181 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00447 |
|---|---|
| Accession No. : | D80003 |
| Description : | Nuclear receptor coactivator 6. |
| HUGO Gene Name : | nuclear receptor coactivator 6 (NCOA6) |
| Clone Name : | ha02522s1 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0181
![]() |
| Source : | Myeloblast cell line (KG-1) |
| Note : | We replaced ha02522, former representative clones for KIAA0181 with ha02522s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6813 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 484 bp Genome contig ID gi51511747r_32666300 PolyA signal sequence
(AATAAA,-32) +----*----+----*----+----*----+----
GTGAATAAAGAGAATCTAAGGATTTGTACAATGTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAATAACGTGTTAAATAAATGTCATTGTCATAGAACATAAAGTTATGTTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 20 r 32766300 32844001 14 99.7 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 2079 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 20 |
| : Genebridge 4 | |
| : TTTCACATTTCCTAAGCAGCC | |
| : TTGCTTTTGCCCCCACTACTG | |
| : 110 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |