ROUGE

Gene/Protein Characteristic Table for mKIAA0181

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129079
Description :	Nuclear receptor coactivator 6.
Clone Name :	mpm10369 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4019 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 509 bp

Genome contig ID gi66880554r_154747605
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
AATACTGAACGTGTTAATAAATGTTTTTGTCATAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACTTAAAGGTATGTTATTGGAAAGAATGAGCAAGCTTTTCTTGTGGGTC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0181 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0181	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..3510
Length: 1169 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH83187	99.9	Nuclear recepto...	Mus musculus
BAE25107	99.8	unnamed protein...	Mus musculus
Q9JL19	99.8	Nuclear recepto...	Mus musculus
EDL85918	94.6	nuclear recepto...	Rattus norvegicus
AAQ08886	100.0	RAP250 [Mus mus...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR000694 67 369 PS50099 Proline-rich region

NULL 82 146 PS50322 NULL

NULL 645 694 PS50324 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR000694	67	369	PS50099	Proline-rich region
NULL	82	146	PS50322	NULL
NULL	645	694	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	509 bp
Genome contig ID	gi66880554r_154747605
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AATACTGAACGTGTTAATAAATGTTTTTGTCATAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTTAAAGGTATGTTATTGGAAAGAATGAGCAAGCTTTTCTTGTGGGTC

Gene/Protein Characteristic Table for mKIAA0181

Features of the cloned DNA sequence

Features of the protein sequence