HUGE

Gene/Protein Characteristic Table for KIAA1819

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01637
Accession No. :	AB058722
Description :	Mastermind-like protein 2.
HUGO Gene Name :	mastermind-like 2 (Drosophila) (MAML2)
Clone Name :	hh00456 [Vector Info]
Flexi ORF Clone :	pF1KSDA1819
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5419 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 672 bp

Genome contig ID gi51511727r_95251088
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
GCTGTGTCTAGTGATTAAACAAAAATATAGAGCTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TGCAATTTGATTTTGGCTTCCACAACGAATATCTGAATCCATTCCAAATG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 95351088 95715992 5 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1173 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8IZL2	100.0	Mastermind-like...	Homo sapiens
NP_115803	99.7	mastermind-like...	Homo sapiens
EAW66975	99.7	mastermind-like...	Homo sapiens
AAI43530	99.8	MAML2 protein [...	Homo sapiens
XP_001147268	98.7	mastermind-like...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058719	7.1e-12	28.4	KIAA1816
D83783	2.1e-09	32.9	KIAA0192
D83785	1.3e-08	26.6	KIAA0200
D80003	5.5e-06	25.4	KIAA0181
AB058721	5.7e-05	23.5	KIAA1818

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AACCTAGAAAACATCCAGTGG

Primer_r
: TCACTAGACACAGCATCCCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AACCTAGAAAACATCCAGTGG
Primer_r	: TCACTAGACACAGCATCCCAC
PCR product length	: 95 bp
PCR conditions	: 15 °C62 sec60 °C30 sec107 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	672 bp
Genome contig ID	gi51511727r_95251088
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- GCTGTGTCTAGTGATTAAACAAAAATATAGAGCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGCAATTTGATTTTGGCTTCCACAACGAATATCTGAATCCATTCCAAATG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	95351088	95715992	5	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1819

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information