ROUGE |
Gene/Protein Characteristic Table for mKIAA0175 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129076 |
---|---|
maternal embryonic leucine zipper kinase. | |
mpj02836 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2423 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 344 bp Genome contig ID gi65493515f_44116887 PolyA signal sequence
(ACTAAA,-21) +----*----+----*----+----*----+----
CAGTTTCTTTCTGAACTAAAACCATTTGTGAATATFlanking genome sequence
(163269 - 163318) ----+----*----+----*----+----*----+----*----+----*
ATCAAGCTCTTTTTTGTATCTGATTTTGATCCAAATAAAACCTCGAATGG
KIAA Alignment based on: KIAA0175 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 133..2079
Length: 648 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |