HUGE |
Gene/Protein Characteristic Table for KIAA0135 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00421 |
---|---|
Accession No. : | D50925 |
Description : | PAS domain-containing serine/threonine-protein kinase. |
HUGO Gene Name : | PAS domain containing serine/threonine kinase (PASK) |
Clone Name : | ha01203s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0135
![]() |
Source : | Myeloblast cell line (KG-1) |
Note : | We replaced ha01203, former representative clones for KIAA0135 with ha01203s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4326 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 269 bp Genome contig ID gi89161199r_241594385 PolyA signal sequence
(ATTAAA,-22) +----*----+----*----+----*----+----
ACTGTTTTATATTATTAAAGGGCTTTTAATTTGTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AACTTCTGAAGGCATGAGTGTTTTCTCTTTCTACTTTTGTATATGTGCAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 r 241694385 241737523 18 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1351 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 2 |
: Stanford G3 | |
: TTCCTGCTTTTCTCCACTTGG | |
: CATCACTGTCTTCTGTTCTGG | |
: 146 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |