HUGE

Gene/Protein Characteristic Table for KIAA0013

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04152
Accession No. :	D87717
Description :	Rho GTPase-activating protein 11A precursor.
HUGO Gene Name :	Rho GTPase activating protein 11A (ARHGAP11A)
Clone Name :	ha00450s1 [Vector Info]
Flexi ORF Clone :	pF1KA0013
Source :	Myeloblast cell line (KG-1)
Note :	We replaced ha00450, former representative clones for KIAA0013 with ha00450s1. (2008/8/27)

Features of the cloned DNA sequence	Description

Length: 5616 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1822 bp

Genome contig ID gi51511731f_28605598
PolyA signal sequence
(AATGAA,-29)
+----*----+----*----+----*----+----
ATCAATAATGAAACATGTCTGTTTTAAAAACTACC
Flanking genome sequence
(2113564 - 2113613)
----+----*----+----*----+----*----+----*----+----*
ACATGTGACTCCTATTTTTGTTAGCTGAAAGCTGCTATACGGAGTATTAC

Features of the protein sequence	Description

Length: 1086 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_510272	99.4	Rho GTPase acti...	Pan troglodytes
Q6P4F7	100.0	Rho GTPase-acti...	Homo sapiens
XP_001084475	93.6	similar to Rho ...	Macaca mulatta
BAG64151	100.0	unnamed protein...	Homo sapiens
EAW92260	99.7	Rho GTPase acti...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D50921	5e-09	28.8	KIAA0131
AB014572	8.8e-09	32.0	KIAA0672
AB007925	9.5e-09	32.0	KIAA0456
AB051510	2.6e-08	32.6	KIAA1723
AB037725	6.7e-08	27.4	KIAA1304

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000198 129 275 PF00620 RhoGAP

HMMSmart IPR000198 126 299 SM00324 RhoGAP

ProfileScan IPR000198 112 302 PS50238 RhoGAP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000198	129	275	PF00620	RhoGAP
HMMSmart	IPR000198	126	299	SM00324	RhoGAP
ProfileScan	IPR000198	112	302	PS50238	RhoGAP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: Stanford G3
Primer_f	: TAGGTTGTAGAGGAAGGAAT
Primer_r	: ATGCTGTAAGTCTGGTTGCT
PCR product length	: 141 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1822 bp
Genome contig ID	gi51511731f_28605598
PolyA signal sequence (AATGAA,-29)	+--------+--------+----*----+---- ATCAATAATGAAACATGTCTGTTTTAAAAACTACC
Flanking genome sequence (2113564 - 2113613)	----+--------+--------+--------+--------+----* ACATGTGACTCCTATTTTTGTTAGCTGAAAGCTGCTATACGGAGTATTAC

Gene/Protein Characteristic Table for KIAA0013

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information