HUGE

Gene/Protein Characteristic Table for KIAA1304

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06987
Accession No. :	AB037725
Description :	SLIT-ROBO Rho GTPase-activating protein 1.
HUGO Gene Name :	SLIT-ROBO Rho GTPase activating protein 1 (SRGAP1)
Clone Name :	fh04032 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5633 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1097 bp

Genome contig ID gi89161190f_62562572
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CAGCCTGGGCAGCATAGTGTGAGACCCTGTCTCTT
Flanking genome sequence
(261257 - 261306)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAATGCTACAAAGTCCTGATGATCCTAAATTTGAAATCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 62662572 62823827 21 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1051 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001164248	99.8	SLIT-ROBO Rho G...	Pan troglodytes
XP_001164049	99.0	SLIT-ROBO Rho G...	Pan troglodytes
XP_001116821	98.9	similar to SLIT...	Macaca mulatta
EAW97122	100.0	SLIT-ROBO Rho G...	Homo sapiens
Q91Z69	97.9	SLIT-ROBO Rho G...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007871	4e-148	68.9	KIAA0411
AB007925	3.1e-129	68.0	KIAA0456
AB032982	7e-52	76.8	KIAA1156
D50921	1.1e-40	46.1	KIAA0131
AB040934	5.8e-09	33.0	KIAA1501

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 714 763 PD000066 Src homology-3

FPrintScan IPR001452 726 741 PR00452 Src homology-3

IPR001452 743 752 PR00452 Src homology-3

IPR001452 754 766 PR00452 Src homology-3

HMMPfam IPR001060 11 110 PF00611 Cdc15/Fes/CIP4

IPR000198 486 638 PF00620 RhoGAP

IPR001452 712 766 PF00018 Src homology-3

HMMSmart IPR001060 11 110 SM00055 Cdc15/Fes/CIP4

IPR000198 483 657 SM00324 RhoGAP

IPR001452 712 767 SM00326 Src homology-3

ProfileScan IPR001060 11 76 PS50133 Cdc15/Fes/CIP4

IPR000198 470 660 PS50238 RhoGAP

IPR001452 709 768 PS50002 Src homology-3

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	714	763	PD000066	Src homology-3
FPrintScan	IPR001452	726	741	PR00452	Src homology-3
IPR001452	743	752	PR00452	Src homology-3
IPR001452	754	766	PR00452	Src homology-3
HMMPfam	IPR001060	11	110	PF00611	Cdc15/Fes/CIP4
IPR000198	486	638	PF00620	RhoGAP
IPR001452	712	766	PF00018	Src homology-3
HMMSmart	IPR001060	11	110	SM00055	Cdc15/Fes/CIP4
IPR000198	483	657	SM00324	RhoGAP
IPR001452	712	767	SM00326	Src homology-3
ProfileScan	IPR001060	11	76	PS50133	Cdc15/Fes/CIP4
IPR000198	470	660	PS50238	RhoGAP
IPR001452	709	768	PS50002	Src homology-3

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACTTGCAATTGTCTCCATGGG

Primer_r
: TTCAAGCAGTAACAGCAGAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1097 bp
Genome contig ID	gi89161190f_62562572
PolyA signal sequence (None)	+--------+--------+----*----+---- CAGCCTGGGCAGCATAGTGTGAGACCCTGTCTCTT
Flanking genome sequence (261257 - 261306)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAATGCTACAAAGTCCTGATGATCCTAAATTTGAAATCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	62662572	62823827	21	99.4	Perfect prediction

Primer_f	: ACTTGCAATTGTCTCCATGGG
Primer_r	: TTCAAGCAGTAACAGCAGAGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1304

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information