HUGE |
Gene/Protein Characteristic Table for KIAA0456 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK01975 |
---|---|
Accession No. : | AB007925 |
Description : | SLIT-ROBO Rho GTPase-activating protein 2. |
HUGO Gene Name : | SLIT-ROBO Rho GTPase activating protein 2 (SRGAP2) |
Clone Name : | hg00633 [Vector Info] |
Flexi ORF Clone : | pF1KA0456
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6305 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Features of the protein sequence |
Description | |
---|---|---|
Length: 1095 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001452 | 757 | 806 | PD000066 | Src homology-3 |
FPrintScan | IPR001452 | 769 | 784 | PR00452 | Src homology-3 |
IPR001452 | 786 | 795 | PR00452 | Src homology-3 | |
IPR001452 | 797 | 809 | PR00452 | Src homology-3 | |
HMMPfam | IPR001060 | 46 | 144 | PF00611 | Cdc15/Fes/CIP4 |
IPR000198 | 529 | 681 | PF00620 | RhoGAP | |
IPR001452 | 755 | 809 | PF00018 | Src homology-3 | |
HMMSmart | IPR001060 | 46 | 144 | SM00055 | Cdc15/Fes/CIP4 |
IPR000198 | 526 | 700 | SM00324 | RhoGAP | |
IPR001452 | 755 | 810 | SM00326 | Src homology-3 | |
ProfileScan | IPR001060 | 46 | 111 | PS50133 | Cdc15/Fes/CIP4 |
IPR000198 | 513 | 703 | PS50238 | RhoGAP | |
IPR001452 | 752 | 811 | PS50002 | Src homology-3 |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
RH mapping information |
Description | |
---|---|---|
: 1 |
: GeneBridge 4 | |
: CACAACATTGCGATTCCCTGG | |
: AGGAGATGAGGAGCGGTGATG | |
: 117 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |