HUGE

Gene/Protein Characteristic Table for KIAA1723

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00902
Accession No. :	AB051510
Description :	Rho GTPase-activating protein 7.
HUGO Gene Name :
Clone Name :	pf00881 [Vector Info]
Flexi ORF Clone :	pF1KSDA1723
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 7365 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2448 bp

Genome contig ID gi51511724r_12885362
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
GTAGGCACCTAATAAATTTATTATTTGCTATACTG
Flanking genome sequence
(99881 - 99832)
----+----*----+----*----+----*----+----*----+----*
AACTGATTGGATTAGCTTCTGTTACTGCAAAGGGAAGAGCATCTAGGATC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 r 12985243 13416686 18 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 1554 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10131	100.0	Rho GTPase-acti...	synthetic construct
EAW63855	99.9	deleted in live...	Homo sapiens
BAF84371	99.8	unnamed protein...	Homo sapiens
AAH54511	99.7	Deleted in live...	Homo sapiens
ACE86794	99.7	deleted in live...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D80011	1.1e-104	42.5	KIAA0189
AB037735	8.3e-08	25.5	KIAA1314
D50921	1.2e-07	30.4	KIAA0131
AB014572	1.6e-07	32.3	KIAA0672
AB051509	3e-07	30.1	KIAA1722

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011510 474 541 PF07647 Sterile alpha motif homology 2

IPR000198 1118 1264 PF00620 RhoGAP

IPR002913 1349 1548 PF01852 Lipid-binding START

HMMSmart IPR000198 1115 1307 SM00324 RhoGAP

IPR002913 1349 1550 SM00234 Lipid-binding START

ProfileScan IPR000198 1104 1310 PS50238 RhoGAP

IPR002913 1340 1525 PS50848 Lipid-binding START

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011510	474	541	PF07647	Sterile alpha motif homology 2
IPR000198	1118	1264	PF00620	RhoGAP
IPR002913	1349	1548	PF01852	Lipid-binding START
HMMSmart	IPR000198	1115	1307	SM00324	RhoGAP
IPR002913	1349	1550	SM00234	Lipid-binding START
ProfileScan	IPR000198	1104	1310	PS50238	RhoGAP
IPR002913	1340	1525	PS50848	Lipid-binding START

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CGCTTTATTTGCAGTGTGTTG

Primer_r
: AGACATCTATTGCCATTCAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2448 bp
Genome contig ID	gi51511724r_12885362
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GTAGGCACCTAATAAATTTATTATTTGCTATACTG
Flanking genome sequence (99881 - 99832)	----+--------+--------+--------+--------+----* AACTGATTGGATTAGCTTCTGTTACTGCAAAGGGAAGAGCATCTAGGATC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	r	12985243	13416686	18	99.3	Perfect prediction

Primer_f	: CGCTTTATTTGCAGTGTGTTG
Primer_r	: AGACATCTATTGCCATTCAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1723

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information