KIAA2016

Product ID	ORK07685
Accession No	AB095936
Description	T-cell lymphoma invasion and metastasis 2
Clone name	pf04366
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6971 bp) Predicted protein sequence (1715 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA2016 by Kazusa Mouse cDNA Project
Note	We replaced fk10510, former representative clones for KIAA2016 with pf04366. (2005/08/06)

Length: 6971 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	592 bp
Genome contig ID	gi89161210f_155095523
PolyA signal sequence (AGTAAA,-19)	+--------+--------+----*----+---- CTCTGCCAAGCTGTATAGTAAAAGGAAAATAAGTC
Flanking genome sequence (525025 - 525074)	----+--------+--------+--------+--------+----* ACATCTGGTCATTGGCATTTGTATCGTCATTCTGTAAAGACAAAAGAGTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	155195523	155620546	29	99.8	Perfect prediction

Length: 1715 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92911	100.0	T-cell lymphoma...	Homo sapiens
Q8IVF5	100.0	T-lymphoma inva...	Homo sapiens
XP_527545	99.3	T-cell lymphoma...	Pan troglodytes
BAG53973	99.9	unnamed protein...	Homo sapiens
XP_419687	77.9	similar to T-ce...	Gallus gallus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037836	3.6e-07	27.7	KIAA1415
AB033082	4.9e-06	26.0	KIAA1256
AB007884	8.9e-06	26.2	KIAA0424
AB002335	1.2e-05	24.3	KIAA0337
AB002378	1.7e-05	21.2	KIAA0380

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	521	634	PF00169	Pleckstrin-like
	IPR001478	904	985	PF00595	PDZ/DHR/GLGF
	IPR000219	1117	1306	PF00621	DH
HMMSmart	IPR001849	521	636	SM00233	Pleckstrin-like
	IPR003116	824	895	SM00455	Raf-like Ras-binding
	IPR001478	914	990	SM00228	PDZ/DHR/GLGF
	IPR000219	1117	1306	SM00325	DH
	IPR001849	1340	1471	SM00233	Pleckstrin-like
ProfileScan	IPR001849	520	634	PS50003	Pleckstrin-like
	IPR003116	824	895	PS50898	Raf-like Ras-binding
	IPR001478	904	990	PS50106	PDZ/DHR/GLGF
	IPR000219	1113	1307	PS50010	DH
ScanRegExp	IPR001331	1255	1280	PS00741	Guanine-nucleotide dissociation stimulator

Primer_f	CTTTTGCTTCCGACATTGATG
Primer_r	GAGTCCTTCTTCGCAGTATCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-